human genetic variations Flashcards
what do we see when we align any 2 genomes ?
- they will look identical at approx. 99.9% of dna bases
- but they will also be 0.1% different
true or false:
the cost of sequencing a genome has dropped rapidly
true
a —– is the introduction of genetic difference to the population which allows for — of new traits and allows the population to – to new environmental stresses as new pathogens
-consequence of reproduction
- evolution
- adapt
genetic variations can be:
1. large scale as
2. small scale as
1- large scale incudes:
- aneuploidy: one or more inidivual c/some in extra copy or missing
- translocation: mixed c/somes
- copy number variant CNVs: relatively large section of dna duplicated or deleted
2- small includes:
- single nucleotide polymorphism SNP: single base pair change
- micorstaletites: repeated units of dna
- insertions and deletion: one or 2 bases duplicated or deleted
—– : one or more individual chromosomes are present in an extra copy, or are missing.
Example here is trisomy of chromosome 21 (Down syndrome)
other trisomy includes:
13 (Patau Syndrome)
18 (Edwards Syndrome)
XXY (Kleinefelters)
- viable monosomy
- incident: rare
- clinical relevance/consequences: Usually causes large-scale changes in gene expression with associated clinical consequences (e.g., learning disability, development delay)
aneuploidy of large scale
is the exchange of dna during meiosis , between 2 different c/somes
- incident: 1;500 newborns
- clinical sigincifacne: Depends on event.
Is there net gain or loss of DNA? (Yes = more likely to be pathogenic)
Is there disruption of gene sequence (Yes = more likely to be pathogenic)
-Can sometimes cause problems in meiosis translocation could cause non-homologous chromosomes to align
-Robertsonian translocations can merge 21q and 14/15q. The progeny of which could end up with one extra 21q: trisomy 21 or Down’s Syndrome
translocation of large scale
Deletions or duplications of DNA of >1000 base-pairs in size. They can be several million bases in size
Incidence: We all carry multiple copy number variants in our genome
Clinical relevance/consequence: Most are benign, but larger ones (>1 million base-pairs) tend to be pathogenic (learning disability, autism, epilepsy etc)
Smaller fraction are selected for – salivary amylase genes in humans
Adaptation to starch-based diets
all refers to:
copy number variant of large scale
—– can merge 21q and 14/15q. The progeny of which could end up with one extra 21q: trisomy 21 or Down’s Syndrome
robertsonian translocation
-Short (2-5bp) repeat units in DNA sequence (most are in non-coding regions)
AKA: Short-tandem repeats (STRs)
-Incidence: common: we all carry approximately 10,000 microsatellites in our genomes.
-Clinical relevance/consequence: rarely disease causing. Vast majority are benign.
- used in forensics and kinship profiling and
- used in early genetic mapping of risk loci prior GWAS
small scale micro satellites
for forensic and kinship profiling —
microsatelites
—- is a single base pair change in dna commonly referred to as SNPS or SNVs ( SN variants )
as:
5’ CGTACGATGACCCA/TAGCTAGCCCT– 3
incident: we all carry around 3.5 million snps
Clinical relevance/consequence – as for microsatellite variation, vast majority are benign, or have very small effect on disease, but in rare cases they can be strong/disease causing
single nucleotide polymorphism
Small sections of DNA (one or a limited number of base-pairs) that are deleted or duplicated
Normal: 5’ – CGTACATGACCCTAGCTAGCCCTA – 3’
Insertion: 5’ – CGTAC[G]ATGACCCTAGCTAGCCCTA – 3’
Deletion: 5’ – CGTAC[-]TGACCCTAGCTAGCCCTA – 3’
Incidence: common: we all carry approximately 20,000 insertions/deletions in our genomes.
Clinical relevance/consequence: rarely disease causing. Vast majority are benign. Can be damaging if they occur in exons.
insertion and deletion ( indels) CHECK SLIDE 14 FOR PROPER EXMAPLES
true or false:
The vast majority of variants land outside of genes (98% of the genome is not ‘genic’). As a result, the majority of variants do not themselves, cause disease.
true
pathogenic variants ( mutations ) alters gene function as:
1.Change the amino acid sequence (non-synonymous mutation)
2.Alter the reading frame of the codons (frameshift mutation)
3.Introduce premature stop of translation (non-sense mutation)
4.Modify splicing (splice-site mutation) or gene expression
5.Rearrange multiple genes (i.e. translocation)
6.Knock-out or increase copy number of a gene (CNV)
the pathogenic variants of large scale ( translocation , CNVS and ploidy )results in:
- gross charges in gene expression as protein levels from multiple different genes are altered example: trisomy 21 and impact on gene expression
- locks out increase number of gene ( CNV)
- rearrange multiple gene ( translation
features of small scale pathogenic variant:
—- is critical for interpretation of small scale coding variation
- genetic variants include:
- reading frame info:
1.Change the amino acid sequence (non-synonymous mutation)
2.Alter the reading frame of the codons (frameshift mutation)
3.Introduce premature stop of translation (non-sense mutation)
4.Modify splicing (splice-site mutation) or gene expression
- genetic code
- for the genetic variant:
1.Silent/synonymous = same aa
2.Missense/nonsynonymous = different AA
3.Nonsense/stop = stop codon introduced
4.Frameshift (from insertion/deletion)
- for reading frame:
-The nucleotide triplets that encode each amino acid in the protein.
-Shift the code by 1 or 2 and you scramble the code
-You create a “frameshift”
-“Triplet repeat” diseases include: Huntington’s
-cancer is characterised by —-
- genetic changes lead to – and it can cause genetic changes
- genomic instabiliy in cancer cells allows — evolution
- each successive variant gives the cells a —-
- critical diver variants allow:
- genomic instability
- cancer ( in somatic cells not gremlin )
- rapid
- growth advantage
- variants are:
1. Genomic instability to persist
2.Safety mechanisms to be bypassed
3.Allow rapid growth and division of cells
4.Allow for metastasis
true or false of the accumulation of somatic variants can lead to cancer:
The lineage of mitotic cell divisions from the fertilized egg to a
single cell within a cancer showing the timing of the somatic variants
acquired by the cancer cell and the processes that contribute to them
true
- we accumulate errors as we — within time
- — plays an important role in growing burden
- accumaltion of somatic variants in lung cells in context of —-
- age
- environment
- smoking and aging
- different cancer arise from —-
- within cancer, —— of cells often exist
- some clone may be — to one phatamlogical agents and some aren’t
- genetic characterisisation of cancer is —- , “Precision medicine” – covers this need to deliver therapies tailored to the specific cancer.
- different tissues
- different clones
- sensitive
- growing field
