human genetic variations Flashcards
what do we see when we align any 2 genomes ?
- they will look identical at approx. 99.9% of dna bases
- but they will also be 0.1% different
true or false:
the cost of sequencing a genome has dropped rapidly
true
a —– is the introduction of genetic difference to the population which allows for — of new traits and allows the population to – to new environmental stresses as new pathogens
-consequence of reproduction
- evolution
- adapt
genetic variations can be:
1. large scale as
2. small scale as
1- large scale incudes:
- aneuploidy: one or more inidivual c/some in extra copy or missing
- translocation: mixed c/somes
- copy number variant CNVs: relatively large section of dna duplicated or deleted
2- small includes:
- single nucleotide polymorphism SNP: single base pair change
- micorstaletites: repeated units of dna
- insertions and deletion: one or 2 bases duplicated or deleted
—– : one or more individual chromosomes are present in an extra copy, or are missing.
Example here is trisomy of chromosome 21 (Down syndrome)
other trisomy includes:
13 (Patau Syndrome)
18 (Edwards Syndrome)
XXY (Kleinefelters)
- viable monosomy
- incident: rare
- clinical relevance/consequences: Usually causes large-scale changes in gene expression with associated clinical consequences (e.g., learning disability, development delay)
aneuploidy of large scale
is the exchange of dna during meiosis , between 2 different c/somes
- incident: 1;500 newborns
- clinical sigincifacne: Depends on event.
Is there net gain or loss of DNA? (Yes = more likely to be pathogenic)
Is there disruption of gene sequence (Yes = more likely to be pathogenic)
-Can sometimes cause problems in meiosis translocation could cause non-homologous chromosomes to align
-Robertsonian translocations can merge 21q and 14/15q. The progeny of which could end up with one extra 21q: trisomy 21 or Down’s Syndrome
translocation of large scale
Deletions or duplications of DNA of >1000 base-pairs in size. They can be several million bases in size
Incidence: We all carry multiple copy number variants in our genome
Clinical relevance/consequence: Most are benign, but larger ones (>1 million base-pairs) tend to be pathogenic (learning disability, autism, epilepsy etc)
Smaller fraction are selected for – salivary amylase genes in humans
Adaptation to starch-based diets
all refers to:
copy number variant of large scale
—– can merge 21q and 14/15q. The progeny of which could end up with one extra 21q: trisomy 21 or Down’s Syndrome
robertsonian translocation
-Short (2-5bp) repeat units in DNA sequence (most are in non-coding regions)
AKA: Short-tandem repeats (STRs)
-Incidence: common: we all carry approximately 10,000 microsatellites in our genomes.
-Clinical relevance/consequence: rarely disease causing. Vast majority are benign.
- used in forensics and kinship profiling and
- used in early genetic mapping of risk loci prior GWAS
small scale micro satellites
for forensic and kinship profiling —
microsatelites
—- is a single base pair change in dna commonly referred to as SNPS or SNVs ( SN variants )
as:
5’ CGTACGATGACCCA/TAGCTAGCCCT– 3
incident: we all carry around 3.5 million snps
Clinical relevance/consequence – as for microsatellite variation, vast majority are benign, or have very small effect on disease, but in rare cases they can be strong/disease causing
single nucleotide polymorphism
Small sections of DNA (one or a limited number of base-pairs) that are deleted or duplicated
Normal: 5’ – CGTACATGACCCTAGCTAGCCCTA – 3’
Insertion: 5’ – CGTAC[G]ATGACCCTAGCTAGCCCTA – 3’
Deletion: 5’ – CGTAC[-]TGACCCTAGCTAGCCCTA – 3’
Incidence: common: we all carry approximately 20,000 insertions/deletions in our genomes.
Clinical relevance/consequence: rarely disease causing. Vast majority are benign. Can be damaging if they occur in exons.
insertion and deletion ( indels) CHECK SLIDE 14 FOR PROPER EXMAPLES
true or false:
The vast majority of variants land outside of genes (98% of the genome is not ‘genic’). As a result, the majority of variants do not themselves, cause disease.
true
pathogenic variants ( mutations ) alters gene function as:
1.Change the amino acid sequence (non-synonymous mutation)
2.Alter the reading frame of the codons (frameshift mutation)
3.Introduce premature stop of translation (non-sense mutation)
4.Modify splicing (splice-site mutation) or gene expression
5.Rearrange multiple genes (i.e. translocation)
6.Knock-out or increase copy number of a gene (CNV)
the pathogenic variants of large scale ( translocation , CNVS and ploidy )results in:
- gross charges in gene expression as protein levels from multiple different genes are altered example: trisomy 21 and impact on gene expression
- locks out increase number of gene ( CNV)
- rearrange multiple gene ( translation
