Week 13 - Lecture 2 Molecular Basis of Cancer

Question 1

What is an example of a very common cancer

Answer 1

Colon cancer

Question 2

What are microsatellites

Answer 2

are repetitive DNA sequences consisting of short repeating nucleotides. They are usually found non-coding DNA, DNA which doesn’t really have a function

CACACACACACACACACACACA dinucleotide repeat

GCAGCAGCAGCAGCAGCAGCA trinucleotide repeat

Question 3

What is microsatellite instability and what causes it

Answer 3

Microsatellite instability (MSI) is a condition characterized by the accumulation of mutations in microsatellites - due to slippage mutation

Question 4

What is the slippage mutation

Answer 4

adding an inappropriate number or not adding enough repeated nucleotide sequence during replication results in high mutation rate.

Question 5

What does microsatellite instability correlate with

Answer 5

the formation of cancer/ the progression of tumorigenesis

Question 6

What are the different support a dentist will provide a patient suffering cancer (4)

Answer 6

1. Early detection of cancer - critical
2. Pre-treatment support - for optimal systemic and oral outcomes
3. Treatment support - likely to have severe to moderate affect (e.g. chemotherapy)
4. Post treatment support - likely to have severe to moderate affects

Question 7

What are 3 methods of cancer treatment (once identified)

Answer 7

1. Surgical excision
2. Radiation Therapy
3. Chemotherapy

Question 8

Explain surgical excision as a treatment method

Answer 8

Depending on the type and how advanced the cancer is this method can:

• Remove the entire tumour
• Debulk a tumour (take out as much of the tumour as you can but leaving some behind and using other methods to kill the remaining tumour)
• Ease Cancer symptoms

The standard practice is to remove surrounding health tissue (and lymphatics) in order to remove all cancerous cells (metastasis)

Question 9

Explain radiation therapy as a treatment method for cancer

Answer 9

Uses beams of high energy electromagnetic radiation to kill cancerous cells. Radiation therapy kills cancer cells by damaging their DNA.
This process takes days or weeks before DNA is damaged enough for cancer cells to die.

Question 10

What does chemotherapy use to treat cancer and what does it target

Answer 10

Cytotoxic Drugs which targets all dividing cells

Question 11

Explain chemotherapy as a treatment for cancer

Answer 11

Chemotherapy is cytotoxic drugs which is administered to kill cancer cells. However, this generally kills ALL dividing cells hence this process can have severe side effects.
Can be used to:
- reduce tumour size before surgery
destroy any remaining tumours after surgery

Question 12

What are the 3 major oral side effects of carcer therapy

Answer 12

1. Chemotherapy can cause Mucositis (inflammation of oral mucosa)
2. Radiation damage to tissue
3. Damage to microbiome

Question 13

Explain the side effect of chemotherapy and mucositis

Answer 13

Cytotoxic drugs do not have a selective action on cancerous cells and damages all dividing cells such as immune cells. Hence side effects include:

• Damage to oral epithelium (inflammation)
• Production and decreased resistance to infection
• Impaired wound healing
• Hair loss
• Sterility
• Carcinogenetic (as it damages DNA, pushing other cells down the path of tumorigenesis)
• Organ damage

Question 14

What are side effects of radiation damage to tissues

Answer 14

Radiation causes similar damage as chemotherapy, but radiation tends to cause more focused and longer lasting side effects. E.g.:
- Radiation damage to tissue
- Mucosal atrophy
- Inflammatory cell infiltrates
- Collagen degradation
- Oedema
- Ulceration
- Complicated by acquired and latent

Question 15

What are side effects on the microbiome from cancer therapy

Answer 15

Both chemotherapy and radiation therapy impact the host oral microbiome.

It can increase the risk of infection (including viral and fungal) further inflammation in the oral cavity

Side effect:
- Taste dysfunction (taste buds are destroyed)
- Nausea and vomiting - oral health implications
- Salivary gland dysfunction
- Neurotoxicity/ pain management (Patients will think that they have a bad infection in their mouth due to a lot of pain - but there’s just damage to the neurons in the mouth )

Question 16

What are hot tumours

Answer 16

• High presence of immune cells (T-cells)
• Suppression of immunosuppressive cell types

Question 17

What are Cold tumours

Answer 17

• Have no immune cells present within the tumour (they can’t get in)
• Immunosuppressive immune cells in tumour