Molecular diagnostic

Question 1

1. The number of human proteins is greater than the number of genes because
   a. alternative splicing and posttranslational modifications occur.
   b. of the 3′ polyadenylation of mRNA.
   c. only some genes are expressed.
   d. the ribosome adds additional noncoded amino acids
   to some mRNAs.

Answer 1

a. alternative splicing and posttranslational modifications occur.

Question 2

2. How much of the human genome is transcribed into RNA?
   a. 0.1%
   b. 1%
   c. 10%
   d. 80% to 100%

Answer 2

d. 80% to 100%

Question 3

3. If there were only 12 amino acids in proteins, what would
   be the minimal length of nucleotides needed for a complete genetic code?
   a. 1
   b. 2
   c. 3
   d. 4

Answer 3

B.2 ?

Question 4

4. The number of DNA bases in a human cell is about
   a. 3 billion
   b. 6 trillion
   c. 20,000
   d. 64

Answer 4

a. 3 billion

Question 5

5. How would the sequence GAATATGCCAGCATATTAG
   translate?
   a. MetProAlaTyr
   b. GluTyrAlaSerIle
   c. It would not translate because the number of bases is
   not divisible by 3.
   d. It would not translate because it will not be transcribed.

Answer 5

c. It would not translate because the number of bases is
not divisible by 3

Question 6

6. Nucleotides that encode protein account for what percentage of the genome?
   a. 1%
   b. 10%
   c. 50%
   d. 90%
   e. 8%

Answer 6

a. 1%

Question 7

7. What approximate percentage of the human genome
   comprises transposable elements?
   a. 1%
   b. 10%
   c. 20%
   d. 30%
   e. 40%

Answer 7

e. 40%

Question 8

8. When massively parallel sequencing generates data with
   a Phred quality score of Q20, the probability of being
   incorrect is which of the following?
   a. 1 in 10
   b. 1 in 100
   c. 1 in 1000
   d. 1 in 10,000
   e. 1 in 100,000

Answer 8

b. 1 in 100

Question 9

9. What is the correct nomenclature for the variant in the
   following sequence if the base in blue boldface text is
   converted to a C? Hint: The sequence includes the initiation codon of the gene.
   ACAGCATAGCATATGACGCATCAGCACATT
   a. GRCh37/hg19 g.32335623
   b. p.W4A
   c. c.12G > C
   d. c.-7G > C
   e. p.T12P

Question 10

10. Hydrogen bonding between which DNA elements is
    required for most molecular diagnostic assays?
    a. Bonds between ribose sugars on different nucleotides
    of a strand of DNA
    b. Bonds between ribose and nucleotide bases
    c. Bonds between two cysteine residues
    d. Bonds between the complementary nucleotide bases

Question 11

11. What nucleotide base is methylated in DNA and at what
    specific location?
    a. Adenine and polyadenylation
    b. Guanine and RNA transcription start site
    c. Thymine and the production of thymine dimers
    d. Cytosine and upstream CpG islands

Question 12

12. Mutations can be generated by incorporating the wrong
    base into DNA during replication, and the mechanism to
    repair this error is
    a. mismatch repair
    b. nucleotide excision repair
    c. base excision repair
    d. homologous recombination repair

Question 13

13. The structure of a human mRNA encoding gene generally contains promoters that are upstream from the transcriptional start site; however, there are other promoters
    that can be both upstream and downstream of the gene.
    Which of the following is one of these promoters?
    a. The TATA box
    b. The polyadenylation site
    c. The enhancer
    d. The proximal core promoter

Question 14

14. An important group of DNA modification enzymes, the
    restriction endonucleases, are used to manipulate DNA
    fragments. What is their function in the organisms from
    which they are isolated?
    a. They digest the ends of DNA to prepare them for
    ligation
    b. They are used to protect themselves from viral infections
    c. They are used in the base excision repair found in
    bacteria
    d. They are RNA-guided nuclease that can precisely
    cleave genomic DNA

Question 15

15. Solid tumors may consist of
    a. 100% tumor cells
    b. a mixture of variable proportions of tumor and normal cells
    c. a mixture of blood vessels, tumor, and normal cells of
    different types
    d. only chromosomal DNA

Question 16

16. Cancer is considered a disease of the genome because
    a. cancer cell nuclei contain no chromosomal DNA
    b. alterations to genes in cancer cells disrupt cellular
    pathways
    c. the genome in cancer cells does not express any genes
    d. the DNA of cancer cells is cross-linked to proteins

Question 17

17. Multiple gene testing of cancer DNA may determine
    a. tumor cellularity
    b. mutations in driver genes that predict a response to
    therapy
    c. prognostic mutations that predict outcome
    d. b and c