MCQ Flashcards
A mRNA is sequenced and found to be 1000 bp long excluding the cap and poly(A) tail. It encodes a 300 amino acid protein. Therefore it can be deduced that:
A)The total length of introns in the mRNA is 100 bp.
B)The total length of the introns in the mRNA is 700 bp.
C)The total length of the 5´ and 3´ untranslated regions (UTRs) in the mRNA is 100 bp.
D)The total length of the 5´ and 3´ untranslated regions (UTRs) in the mRNA is 700 bp.
C
During transcription the DNA sequence 5′-TTTCACGGTCTA-3′ can act as template for synthesis of which mRNA sequence? A)5′-AAAGUGCCAGAU-3′ B)5′-AUCUGGCACUUU-3′ C)5′-UUUCACGGUCUA-3′ D)5′-UAGACCGUGAAA-3′
D
Within gene sequences, introns can occur in …
A) the 5′ untranslated region (UTR), and the 3′ UTR
B) the 5′ UTR, the coding region, and the 3′ UTR
C) the coding region
D) the promoter, the 5′ UTR, the coding region, and the 3′ UTR
B
Which of the following are ribonucleoproteins?
1) nucleosome
2) replisome
3) ribosome
4) spliceosome
Select one: A) 1 and 2 B) 2 and 3 C) 3 and 4 D) 1, 2 and 4
C
During translation of mRNA…
A) both start and stop codons are translated into amino acids in the final protein
B) neither start nor stop codons are translated into amino acids in the final protein
C) the start codon but not the stop codon is translated into an amino acid in the final protein
D) the stop codon but not the start codon is translated into an amino acid in the final protein
C
If AUG = Met = start codon UUG = Leu AAC = Asn AGC = Ser GAG = Glu UAA = Stop CCC = Pro Then a mRNA sequence: [5´cap]-CCC UUG AUG GAG AGC CCC UAA UUG AAC-[poly(A)-tail]- 3´ ...in most eukaryotes will code for peptide(s)
Select one: A) Met-Glu-Ser-Pro B) Pro-Leu-Leu-Asn C) Pro-Leu-Met-Glu-Ser-Pro D) Pro-Leu-Met-Glu-Ser-Pro-Leu-Asn
A
In 1958 Meselson and Stahl showed that …
Select one: A) DNA has a double helix structure. B) DNA is the genetic material. C) DNA replication is semi-conservative. D) Three bases code for one amino acid.
C
On Venus life has an RNA genetic material with six possible bases. Venusian RNA codes for proteins which contain 25 types of amino acid. What is the minimum number of bases in a codon?
Select one: A) 1 B) 2 C) 3 D) 4
B
Scientists use the polymerase chain reaction (PCR) to …
Select one: A) amplify DNA in vitro B) transcribe DNA in vivo C) transcribe DNA in vitro D) translate RNA in vivo
A
During gel electrophoresis DNA molecules migrate to the other end of the gel because
Select one: A) DNA diffuses at a rate dependent on its size and conformation B) DNA is attracted to UV light C) DNA is double stranded D) DNA is negatively charged
D
A gene is cut at one end by a restriction enzyme which leaves a 5´GATC- overhang. What should be the complementary overhang for your plasmid?
Select one: A) 3´CTAG- B) 5´CTAG- C) 3´GATC- D) 5´GATC
D
Histones can be modified by: 1 acetylation 2 methylation 3 phosphorylation 4 ubiquitylation
Select one: A) 1 and 2 B) 1, 3 and 4 C) 1, 2, 3 and 4 D) 2 and 3
C
RNA: 1 can carry genetic information. 2 can catalyse biochemical reactions. 3 is more stable than DNA. 4 can chemically bond with amino acids.
Select one: A) 1 and 2 B) 1, 3 and 4 C) 1, 2 and 4 D) 1, 2, 3 and 4
C
What does a pyrimidine deoxyribonucleotide contain?
- Pyrimidine (single-ring) base
- Deoxyribose sugar (no hydroxyl group on the 2’ carbon atom)
- Nucleotide (contains phosphate groups)
If a species contains 23 % adenine in its DNA, what is the percentage of guanine it would contain?
Select one: A) 23 % B) 27% C) 46% D) 54%
B (From the base-pairing rules, A = T and C = G. So A + T = 23 x 2 = 46 %. Therefore G + C = 54 % and G = 54/2 = 27 %.)
DNA was first discovered by:
Select one: A) Friedrich Miescher B) Gregor Mendel C) James Watson and Francis Crick D) Rosalind Franklin
A
A circular bacterial chromosome contains 2 Mb DNA. How long would DNA replication take if replisome speed is 1 kb s-1?
Select one: A) 500 s B) 1000 s C) 2000 s D) 4000 s
B (DNA replication is bidirectional from the origin of replication so the total rate of replication is 2 x 1 kb s^-1. The whole chromosome will therefore be replicated in 2 x 10^6 b / 2 x 10^3 b s-1 = 10^3 s.)
In humans, DNA replication occurs in the
1) mitochondria
2) nucleus
3) ribosomes
4) rough endoplasmic reticulum
Select one: A) 1 and 2 B) 2 C) 2 and 3 D) 3 and 4
A (DNA is present in both the nucleus and mitochondria of human cells, so these are the sites of DNA replication. In plants, DNA replication would also take place in chloroplasts.)
Consider this double-stranded DNA fragment, which is part of a much larger chromosome:
5′–ATTCGTACGATCGACTGACTGACAGTC–3′
3′–TAAGCATGCTAGCTGACTGACTGTCAG–5′
If this DNA fragment is replicated in a left-to-right direction (i.e. the direction of travel of the replisome is left-to-right), which of the following sequences could be part of an Okazaki fragment?
Select one: A) 5′-ATTCGTACGATCGACTGACTGACAGTC-3′ B) 5′-TAAGCATGCTAGCTGACTGACTGTCAG-3′ C) 5′-GACTGTCAGTCAGTCGATCGTACGAAT-3′ D) 5′-CTGACAGTCAGTCAGCTAGCATGCTTA-3′
C (If DNA replication is left-to-right then the bottom strand will act as a template for 5′-to-3′ left-to-right synthesis (i.e. the leading strand). Okazaki fragments are synthesised on the lagging strand so will be complementary to the top DNA strand. The sequence 5′-GACTGTCAGTCAGTCGATCGTACGAAT-3′ is complementary to the top strand (remember that base paired nucleic acids are antiparallel), so this could be part of an Okazaki fragment.)
The restriction endonuclease SexAI cuts DNA at the sequence ACCWGGT (where W is A or T). If it is used to digest a 5 megabase bacterial genome, approximately how many fragments will be formed?
Select one: A) 18 B) 600 C) 1800 D) 190000
B (The restriction endonuclease SexA1 from the bacterium Streptomyces exfoliatus cuts at the sequence ACCWGGT where W is A or T. Therefore on average it will cut DNA of random base composition once in every 4x4x4x2x4x4x4 bp = once in every 8192 bp. Therefore it will cut a 5 megabase DNA 5,000,000/8192 = 610.35 or approximately 600 times.)
Non-disjunction during meiosis II will result in which of the following gametes?
Select one:
A) all monosomic gametes.
B) all trisomic gametes
two gametes with an extra
C) chromosome copy, and two gametes missing a copy of one of the chromosomes
D) two haploid gametes, one gamete with an extra chromosome copy, and one gamete missing a copy of one of the chromosomes
D
In an F2 generation, how many genotypic classes are possible from a dihybrid cross of two heterozygotes in which the genes involved show complete dominance?
Select one: A) 4 B) 8 C) 9 D) 12
C
A student is studying the genetics of flower colour in a large population of outcrossing plants. She finds that there are blue, red and purple flowered plants. She takes plants of each colour into the greenhouse and self-fertilises them. She finds that the blue and red plants produce only blue and red plants respectively, but the purple plants produce red, blue and purple offspring. If she crossed purple plants to red plants, what offspring would you expect her to obtain and in what ratios?
Select one: A) 1 red : 1 purple B) 1 red : 2 purple : 1 blue C) All purple D) All red
A
In tobacco, there are two independent genes governing seedling colour. Only the genotype aabb is white, all others being green. What is the expected ratio of green: white seedlings in a cross between Aabb x AaBb?
Select one: A) 3:1 B) 7:1 C) 9:1 D) 15:1
B
Sickle cell anaemia is a recessive trait in humans. In a cross between a father who has sickle cell anaemia and mother who is heterozygous for the gene, what is the probability that their first three children will be normal?
Select one: A) zero B) 1/8 C) 1/4 D) 1/2
B
