Chapter 6: Part 2.Test Review

Question 1

What does RNA stand for?

Answer 1

Ribonucleic acid

Question 2

What is heredity?

Answer 2

The passing of traits from parents to offspring.

Question 3

What is a trait?

Answer 3

Something that passes through generations

Question 4

We receive how many copies of our genes from each of our parents?

Answer 4

23

Question 5

What is a homozygote?

Answer 5

.

Question 6

What is a heterozygote?

Answer 6

.

Question 7

What is a dominant trait?

Answer 7

.

Question 8

What is a recessive trait?

Answer 8

.

Question 9

What is a genotype?

Answer 9

.

Question 10

What a phenotype?

Answer 10

.

Question 11

What is a Punnet square?

Answer 11

.

Question 12

What is complete dominance?

Answer 12

.

Question 13

What is incomplete dominance?

Answer 13

.

Question 14

What is a blended phenotype?

Answer 14

.

Question 15

What is the flow of genetic information in a cell?

Answer 15

.

Question 16

What features do DNA and RNA share in common?

Answer 16

.

Question 17

How is RNA different from DNA?

Answer 17

.

Question 18

What is a messenger RNA and where is it made?

Answer 18

.

Question 19

What is the complimentary mRNA sequence for this DNA sequence?
ACTGCCAATGGCCTGCTATAGACCCG

Answer 19

ACTGCCAATGGCCTGCTATAGACCCG

Question 20

mRNA contains the information from what? To be a template to make what?

Answer 20

.

Question 21

Where does mRNA go after it is made?

Answer 21

.

Question 22

What do ribosomes do?

Answer 22

.

Question 23

What is a condon?

Answer 23

the genetic coding in humans.

Question 24

How many different types of amino acids do we use to make proteins?

Answer 24

20

Question 25

What are our sources of amino acids?

Answer 25

golgi bodies.

Question 26

How do amino acids get to the ribosome?

Answer 26

.

Question 27

How does the ribosome know what amino acid to add to the growing protein chain?

Answer 27

.

Question 28

What is an anticodon?

Answer 28

.

Question 29

How does a ribosome know when to stop adding amino acids to a protein chain?

Answer 29

.

Question 30

AAA or AAG=serine, CCC or CCU=glycine, UUU=phenylalanine, UAG=stop Write the amino acid sequence for this mRNA

Answer 30

.

Question 31

What is the process of making proteins called?

Answer 31

heredity

Question 32

What are some functions carried out by proteins?

Answer 32

golgi bodies, ribosomes, genomes.

Question 33

Can you do a two trait Punnet Square? Do some practice 2 trait Punnet Squares.

Answer 33

.

Question 34

You see 3 blue molds for every 1 yellow on your sandwich. What type of dominance is this? What genotypes would be blue (BB, Bb and bb)? What genotypes would be yellow (BB, Bb, bb)? Fill in the Punnett square below crossing Bb with Bb. List genotype and phenotypes for you cross.

Answer 34

Complete

Question 35

You see 1 blue mold for every 2 purple molds for every 1 red mold on your sandwich. What type of dominance is this? What genotypes would be blue (BB, Bb or bb)? What genotypes would be purple (BB, Bb or bb)? What genotypes would be red (BB, Bb or bb)? Fill in the Punnett square below crossing BB with Bb. List the genotype an phenotypes for you cross.

Answer 35

incomplete BB Bb bb