Homework 2 Flashcards
Which component is not included in a nucleoside?
phosphate group
ribose
nitrogenous base
2-deoxyribose
phosphate group
Nucleotides contain one or more phosphate groups that are usually attached to the ______.
C-3’ or C-5’ atoms
C-3 or C-3’ atoms
C-5 or N-3 atoms
C-1’ or N-3 atoms
none of the above
C-3’ or C-5’ atoms
In the structure of DNA, the bases in complementary strands interact through ______________, while the bases within one strand interact through _____________ ; lastly, phosphodiester groups interact with magnesium ions through _________________
Hydrogen bonds, pi-pi interactions, ionic interactions.
What is the purpose of Taq Polymerase in a polymerase chain reaction?
It is the heat-stable enzyme that replicates DNA.
It is a short fragment of DNA that attaches to the region of DNA to be copied.
It serves as the template for the DNA to be copied.
It is the building block of DNA.
It is the heat-stable enzyme that replicates DNA.
Which of the following is FALSE regarding plasmids found in bacterial cells?
They are part of the cell’s genome.
They are small, circular molecules of single-stranded DNA.
They may make the cell more virulent.
They may confer antibiotic resistance on the cell.
They are small, circular molecules of single-stranded DNA.
Dideoxy analogs are used in Sanger sequencing for what reason?
They facilitate polymerization of the DNA.
They block further elongation of the DNA.
They facilitate fluorescent DNA sequencing.
They facilitate elongation of the DNA fragments.
They block further elongation of the DNA.
In order to perform PCR, which of the following describes the reagents that must be included in the reaction mixture?
DNA fragment, primers flanking the region of interest, dNTPs, DNA polymerase
DNA fragment, primers flanking the region of interest, dNTPs, ddNTPS, DNA polymerase
DNA fragment, one primer, dNTPs, DNA polymerase, DNA ligase
DNA fragment, primers flanking the region of interest, dNTPs, DNA Ligase
none of the above
DNA fragment, primers flanking the region of interest, dNTPs, DNA polymerase
EcoRI recognizes the sequence 5’-G↓AATTC-3’ (the arrow indicates the point of cleavage). Treatment of the following oligonucleotide with EcoRI would produce two oligonucleotides with sizes of _____ nucleotides containing _____ ends.
5’–AAGTCGATACAGAATTCGTACCTAG–3’
11 and 8; sticky
9 and 13; sticky
12 and 8; blunt
12 and 13; sticky
12 and 13; blunt
12 and 13; sticky
Organisms that harbor a foreign gene as a result of recombinant gene manipulation are termed as ________.
genetically modified
transgenic
transformers
mutants
transgenic
Plasmids are small, circular molecules of ____________ stranded DNA.
Double.
