Ch.8

Question 1

What is the shape of DNA (deoxyribose nucleic acid)?

Answer 1

double helix with two strands madeup of nucleotides

Question 2

How is the shape of bacterial DNA different from eukaryotes?

Answer 2

Bacteria have one circular double stranded DNA (supercoiled) and eukaryotes can be linear OR circular

Question 3

What are the four nitrogen bases

Answer 3

–Adenine (A)
–Thymine (T)
–Guanine (G)
–Cytosine (C)

Question 4

1. Each nucleotide consists of what 3 thigs?
2. DNA is a polymer made up of what?

Answer 4

1. a sugar (deoxyribose), a phosphate, and a base.
2. nucleotides

Question 5

1. The two strands of
   DNA are (parallel or antiparallel)?
2. The backbone of one
   strand is (upright/ upside down) relative to
   the backbone of
   the other strand.

Answer 5

1. antiparallel
2. upside down

Question 6

Adenine (A) can only bond
with ___________

*___________ can only bond
with cytosine (C)

(T/F) Each strand of DNA
in a double helix is
complementary.

Answer 6

Adenine (a) >THYMINE (t)

GUANINE (g) >cytosine (c)

TRUE

Question 7

1. what unwinds the DNA double helix?
2. what does helicase do?
3. the leading strand is synthesized continuously while the lagging strand is synthesized _______________?
4. what RNA polymerase synthesizes a short RNA primer, which is extended by
   DNA polymerase?

Answer 7

1. topoisomerases
2. separates the strand
3. discontinuously
4. primase

Question 8

Are DNA strands complimentary?

What does each strand serve as?

What are new DNA molecules made up of?

DNA replication is AKA what?

Answer 8

YES

a template to build a new strand

original parental strands + a new half

Semi-conservative

Question 9

What two enzymes are responsible for relaxing the DNA strand?

Answer 9

1. Topoisomerase
2. DNA gyrase

Question 10

A & T have a _______ bond
while C & G have a _________ bond

Answer 10

A-T: double bond
C-G: triple bond

Question 11

DNA REPLICATION

1. when a nucleoside triphosphate bonds to the sugar, it loses how many phosphates?
2. what provides the energy needed for the reaction?

Answer 11

1. two
2. Hydrolysis of the phosphate bonds

Question 12

What 2 things does DNA polymerase do?

Answer 12

adds nucleotides to the growing DNA strand and removes RNA primers

Question 13

What is the difference between the leading strand and the lagging strand?
- what does the lagging strand have that the leading strand does not?

Answer 13

Leading strand: synthesized continuously
Lagging strand: synthesized discontinuously, creating OKAZAKI fragments

Question 14

What capability does replication have that makes it highly accurate?

Answer 14

it has a proofreading capability of DNA polymerase

Question 15

__________ of replication occurs on a single circular chromosome while _________occurs directly opposite of the __________ where the two replication forks meet.

Answer 15

Origin
Termination
Origin

Question 16

1. Where are short tandem repeats (STRs) sites found?
2. At each STRs site, a four-nucleotide
   sequence is repeated many times in a
   row what is it?
3. These sites vary so widely that no two humans have the same number of repeats at all 13 sites except who?

Answer 16

1. scattered throughout human genomes
2. AGATAGATAGATAGATAGAT
3. identical twins

Question 17

1. why is DNA is able to act as the molecule
   of heredity?
2. DNA first directs the production of
   RNA (_____________), which in turn
   controls the manufacture of
   proteins (__________________).
3. Proteins then perform what two things?

Answer 17

1. can direct the production of proteins
2. transcription, translation
3. cellular functions and control physical traits.

Question 18

1. _________
   (recipies/genes)
   |
   RNA
   (2. _________ )
   |
   Proteins
   (traits)

Answer 18

1. DNA
2. Message

Question 19

RNA has three major differences what are they? (strand, sugar, nitrogen base)

Answer 19

1. single stranded (not helix)
2. sugar in RNA is ribose
3. contains uracil instead of thymine

Question 20

Where does transcription occur in:

Prokaryotes?

Eukaryotes?

Where does TRANSLATION OCCUR in both prokaryotes and Eukaryotes?

Answer 20

P transcription: cytoplasm
E transcription: nucleus
Translation in both: cytoplasm

Question 21

In transcription, how many strands of DNA is transcribed into mRNA?

Are anticodons or codons present on mRNA

Answer 21

Only ONE of the two strands of DNA

Codons

Question 22

What is the difference between sense strand and antisense strand?

Answer 22

SENSE strand (DNA): coding strand, plus strand or non-template strand (messenger)

ANTISENSE strand (DNA): non-coding strand, minus strand or template strand

Question 23

_________________: transcription begins when RNA polymerase binds to the promoter sequence
on DNA

Elongation: transcription proceeds in ___________ direction of the growing RNA, adding ribonucleotides

Termination: what happens here?

Answer 23

Initiation

5’ to 3’

transcription stops when it
reaches the terminator sequence on DNA

Question 24

What is the function of Transfer RNA (tRNA)?

____________: three bases
on tRNA that recognize
complementary codon on
mRNA

Answer 24

Carries amino acids to the
translation machinery

Anticodon

Question 25

1. Translation involves what three kinds of RNA? 2. where does translation of mRNA occur? 3. ______: serves as a “blueprint” that carries coded information from DNA to make proteins 4. Ribosomes are made from proteins and what? 5. which RNA molecules carry amino acids to the ribosome. It contains anti-codons, which are complementary to the codons on mRNA

Answer 25

1. rRNA, mRNA, and tRNA. 2. cytoplasm within the ribosomes 3. mRNA 4. Ribosomal RNA (rRNA). 5. Transfer RNA (tRNA)

Question 26

1. what is a sequence of three mRNA nucleotides that code for a particular amino acid called? 2. How many sense codons? – 64 different codons – ____ sense codons encode the 20 amino acids. 3. Includes one start codon what is it? 4. UAA, UAG, UGA are all what? 5. The genetic code involves ___________, meaning each amino acid is coded by more than one codon

Answer 26

1. codons 2. 61 3. AUG 4. the 3 stop codons 5. degeneracy

Question 27

Translation of mRNA begins at the start codon: ________ Translation ends at stop (nonsense) codons: _______, ________, ________. Amino acids are joined by _______ ______.

Answer 27

Start; AUG Stop; UAA, UAG, UGA. peptide bonds

Question 28

In elongation of translation, where is mRNA translated?

Answer 28

in codons

Question 29

In translation, tRNA molecule recognizes the start codon (AUG) on mRNA with its anticodon (UAC). What is the first amino acid translated?

Answer 29

methionine

Question 30

T/F In bacteria, translation can begin before transcription is complete If true, why?

Answer 30

TRUE transcription is actually occurring in the cytoplasm and the mRNA being transcribed is available to ribosomes before

Question 31

How do we know when translation ends?

Answer 31

ribosomes reach the termination codon

Question 32

1. In eukaryotes what are exons? 2. Introns? 3. what remove introns and splice exons together?

Answer 32

1. regions of DNA that code for proteins 2. regions of DNA that do not code 3. Small nuclear ribonucleoproteins (snRNPs

Question 33

Define mutation

Answer 33

a permanent change in the base sequence of DNA that leads to the change in phenotype

Question 34

1. name the 2 types of mutations 2. when can mutations be spontaneous? 3. Induced mutations are caused by what? * High-energy radiation * Chemical 4. define mutagens

Answer 34

1. spontaneous and induced 2. during DNA replication errors 3. mutagens 4. agents that cause mutations

Question 35

Change in DNA may cause a change in the product encoded by the gene. What is this called and what can it impact?

Answer 35

genetic variations; can impact microbial function

Question 36

T/F Survival and reproduction of a microbe with a new genotype are not favored by natural or man-made environments

Answer 36

FALSE, they MAY BE favored by natural or man-made environments

Question 37

Mutations can lead to unique traits and are the raw material of evolution by _________ _________.

Answer 37

natural selection

Question 38

a strain of any cell or virus differing from parental strain in genotype

Answer 38

Mutant

Question 39

Typically refers to strain isolated from nature

Answer 39

Wild-type strain

Question 40

structurally similar to normal nitrogenous bases, but incorporate into DNA in place of a normal base and cause mistakes in base pairing

Answer 40

Nucleoside analog

Question 41

Which type of mutation doesn’t affect the activity of the product? – Degeneracy of the genetic code – Doesn’t change the amino acid sequence of resulting protein

Answer 41

Silent (Neutral) mutation

Question 42

How do photolyases and nucleotide excision repair uv -induced damage?

Answer 42

- photolyases: use light to separate thymine dimers - nucleotide excision repair: cuts out incorrect bases

Question 43

1. What happens in Missense mutation? 2. What happens in Nonsense mutation?

Answer 43

1. Base substitution results in change in an amino acid 2. Base substitution results in a nonsense (stop) codon (UAA, UGA, UAG)

Question 44

1. where do point mutations occur? 2. T or F point mutations can have varying effects

Answer 44

1. occur at a single nucleotide 2. True

Question 45

Which mutations are the most detrimental and result in different or defective proteins?

Answer 45

Frameshift mutations (both additions or deletions)

Question 46

Which type of mutation causes change in only one base of DNA and can lead to single amino acid change in a protein, or no change at all?

Answer 46

Base substitution (point mutation)

Question 47

Define frameshift mutation

Answer 47

Insertion or deletion of one or more nucleotide pairs - result in shift of reading frame

Question 48

___________: addition of 1 base causes a frame shift ____________: removal of 1 base causes a frame shift Normal: THE CAT RAN BUT THE DOG DID NOT ____________: ATH ECA TRA NBU TTH EDO GDI DNO T Normal: THE CAT RAN BUT THE DOG DID NOT _____________: HEC ATR ANB UTT HED OGD IDN OT

Answer 48

Insertion deletion insertion deletion

Question 49

what are the 3 types of plasmids?

Answer 49

1. Resistance (R) factor plasmid 2. Conjugative plasmid 3. Dissimilation plasmids

Question 49

What 2 structures found are known as mobile genetic elements (move from one cell to another or from one chromosome to another) What type of organisms does this occur in?

Answer 49

Plasmids and Transposons Prokaryotic & Eukaryotic

Question 50

What are self-replicating circular pieces of DNA, found in bacteria?

Answer 50

Plasmids

Question 51

1. Which plasmid encodes antibiotic resistance, sometimes to multiple different antibiotics? 2. what do conjugative plasmids carry for sex pili and transfer of the plasmids? 3. what do dissimilation plasmids encode enzymes for?

Answer 51

1. Resistance (R) factor plasmid 2. genes 3. catabolism of unusual compounds

Question 51

Define Resistance (R) factor plasmids:

Answer 51

plasmids that encode antibiotic resistance; some can be transferred horizontally

Question 52

Segments of DNA that can move from one region of DNA to another What do transposons contain that code for transposase? What is the function of transposase?

Answer 52

Transposons Insertion sequences cut and reseal DNA

Question 53

Define recalcitrant

Answer 53

distinguished ability to resist change in some property

Question 54

1. who/which experiment first demonstrated transformation and with what bacteria? 2. what did this process set the stage for?

Answer 54

1. Fredrick Griffith’s experiment (Late 1920’s), Streptococcus pneumoniae 2. discovery of DNA

Question 54

____________: return the environment altered by contaminants to its original condition

Answer 54

Bioremediation

Question 55

1. How does transformation occur (naturally or artificially) among several bacteria genera? 2. what are competent cells?

Answer 55

1. occurs naturally 2. cells that are capable of taking up DNA and being transformed

Question 56

Plasmids are transferred from one bacterium to another through cell-to-cell contact. What is this known as?

Answer 56

Conjugation in Bacteria

Question 57

CONJUGATION in Bacteria What do gram- bacteria use for attachment and transfer? - how is it encoded? In gram+ bacteria what holds participating cells together?

Answer 57

sex pili - encoded by conjugative plasmid a sticky substance

Question 58

1. T or F in conjugation cells must be opposite mating types 2. who carries conjugative plasmid (F factor) and can produce sex pili? 3. Does the donor (f+, male) or recipients (f-, female) lack the conjugative plasmid 4. After conjugation the recipient (F- ) will become what?

Answer 58

1. True 2. Donor or F+ cell or Male 3. Recipient or F- cell or Female: 4. F+

Question 59

Define Hfr cells What do Hfr cells contain?

Answer 59

High frequency cells F factor integrated into the chromosome

Question 60

Movement of genetic information between more or less distantly related organisms, and thus stands in distinction to the standard vertical transmission of genes from parent

Answer 60

Horizontal/Lateral gene transfer (HGT)

Question 61

in transduction, DNA is transferred from a bacterial donor cell to a recipient via a what? (a virus that infects bacteria)

Answer 61

bacteriophage

Question 62

1. _____________ transduction: RANDOM bacterial DNA is packaged inside a phage and transferred to a recipient cell 2. _________________ transduction: SPECIFIC bacterial genes are packaged inside a phage and transferred to a recipient cell

Answer 62

1. generalized transduction 2. specialized transduction