Ch.8 Flashcards
What is the shape of DNA (deoxyribose nucleic acid)?
double helix with two strands madeup of nucleotides
How is the shape of bacterial DNA different from eukaryotes?
Bacteria have one circular double stranded DNA (supercoiled) and eukaryotes can be linear OR circular
What are the four nitrogen bases
–Adenine (A)
–Thymine (T)
–Guanine (G)
–Cytosine (C)
- Each nucleotide consists of what 3 thigs?
- DNA is a polymer made up of what?
- a sugar (deoxyribose), a phosphate, and a base.
- nucleotides
- The two strands of
DNA are (parallel or antiparallel)? - The backbone of one
strand is (upright/ upside down) relative to
the backbone of
the other strand.
- antiparallel
- upside down
Adenine (A) can only bond
with ___________
*___________ can only bond
with cytosine (C)
(T/F) Each strand of DNA
in a double helix is
complementary.
Adenine (a) >THYMINE (t)
GUANINE (g) >cytosine (c)
TRUE
- what unwinds the DNA double helix?
- what does helicase do?
- the leading strand is synthesized continuously while the lagging strand is synthesized _______________?
- what RNA polymerase synthesizes a short RNA primer, which is extended by
DNA polymerase?
- topoisomerases
- separates the strand
- discontinuously
- primase
Are DNA strands complimentary?
What does each strand serve as?
What are new DNA molecules made up of?
DNA replication is AKA what?
YES
a template to build a new strand
original parental strands + a new half
Semi-conservative
What two enzymes are responsible for relaxing the DNA strand?
- Topoisomerase
- DNA gyrase
A & T have a _______ bond
while C & G have a _________ bond
A-T: double bond
C-G: triple bond
DNA REPLICATION
- when a nucleoside triphosphate bonds to the sugar, it loses how many phosphates?
- what provides the energy needed for the reaction?
- two
- Hydrolysis of the phosphate bonds
What 2 things does DNA polymerase do?
adds nucleotides to the growing DNA strand and removes RNA primers
What is the difference between the leading strand and the lagging strand?
- what does the lagging strand have that the leading strand does not?
Leading strand: synthesized continuously
Lagging strand: synthesized discontinuously, creating OKAZAKI fragments
What capability does replication have that makes it highly accurate?
it has a proofreading capability of DNA polymerase
__________ of replication occurs on a single circular chromosome while _________occurs directly opposite of the __________ where the two replication forks meet.
Origin
Termination
Origin
- Where are short tandem repeats (STRs) sites found?
- At each STRs site, a four-nucleotide
sequence is repeated many times in a
row what is it? - These sites vary so widely that no two humans have the same number of repeats at all 13 sites except who?
- scattered throughout human genomes
- AGATAGATAGATAGATAGAT
- identical twins
- why is DNA is able to act as the molecule
of heredity? - DNA first directs the production of
RNA (_____________), which in turn
controls the manufacture of
proteins (__________________). - Proteins then perform what two things?
- can direct the production of proteins
- transcription, translation
- cellular functions and control physical traits.
- _________
(recipies/genes)
|
RNA
(2. _________ )
|
Proteins
(traits)
- DNA
- Message
RNA has three major differences what are they? (strand, sugar, nitrogen base)
- single stranded (not helix)
- sugar in RNA is ribose
- contains uracil instead of thymine
Where does transcription occur in:
Prokaryotes?
Eukaryotes?
Where does TRANSLATION OCCUR in both prokaryotes and Eukaryotes?
P transcription: cytoplasm
E transcription: nucleus
Translation in both: cytoplasm
In transcription, how many strands of DNA is transcribed into mRNA?
Are anticodons or codons present on mRNA
Only ONE of the two strands of DNA
Codons
What is the difference between sense strand and antisense strand?
SENSE strand (DNA): coding strand, plus strand or non-template strand (messenger)
ANTISENSE strand (DNA): non-coding strand, minus strand or template strand
_________________: transcription begins when RNA polymerase binds to the promoter sequence
on DNA
Elongation: transcription proceeds in ___________ direction of the growing RNA, adding ribonucleotides
Termination: what happens here?
Initiation
5’ to 3’
transcription stops when it
reaches the terminator sequence on DNA
What is the function of Transfer RNA (tRNA)?
____________: three bases
on tRNA that recognize
complementary codon on
mRNA
Carries amino acids to the
translation machinery
Anticodon
- Translation involves what three kinds of
RNA? - where does translation of mRNA occur?
- ______: serves as a “blueprint” that carries coded information from DNA to make proteins
- Ribosomes are made from proteins and what?
- which RNA molecules carry amino acids to the ribosome. It contains anti-codons, which are complementary to the codons on mRNA
- rRNA, mRNA, and tRNA.
- cytoplasm within the ribosomes
- mRNA
- Ribosomal RNA (rRNA).
- Transfer RNA (tRNA)
- what is a sequence of three
mRNA nucleotides that code
for a particular amino acid called? - How many sense codons?
– 64 different codons
– ____ sense codons encode
the 20 amino acids. - Includes one start
codon what is it? - UAA, UAG, UGA are all what?
- The genetic code involves
___________, meaning
each amino acid is coded by
more than one codon
- codons
- 61
- AUG
- the 3 stop codons
- degeneracy
Translation of mRNA begins at the start codon: ________
Translation ends at stop (nonsense) codons:
_______, ________, ________.
Amino acids are joined by _______ ______.
Start; AUG
Stop; UAA, UAG, UGA.
peptide bonds
In elongation of translation, where is mRNA translated?
in codons
In translation, tRNA molecule recognizes the start codon (AUG) on mRNA
with its anticodon (UAC). What is the first amino acid translated?
methionine
T/F In bacteria, translation can begin before transcription is complete
If true, why?
TRUE
transcription is actually occurring in the cytoplasm and the mRNA being transcribed is available to
ribosomes before
How do we know when translation ends?
ribosomes reach the termination codon
- In eukaryotes what are exons?
- Introns?
- what remove introns and splice exons together?
- regions of DNA that code for proteins
- regions of DNA that do not code
- Small nuclear ribonucleoproteins (snRNPs
Define mutation
a permanent change in the
base sequence of DNA that leads to the change in phenotype
- name the 2 types of mutations
- when can mutations be spontaneous?
- Induced mutations are caused by what?
* High-energy radiation
* Chemical - define mutagens
- spontaneous and induced
- during DNA replication errors
- mutagens
- agents that cause mutations
Change in DNA may cause a change in the product encoded by the gene.
What is this called and what can it impact?
genetic variations; can impact microbial function
T/F Survival and reproduction of a microbe with a new
genotype are not favored by natural or man-made
environments
FALSE, they MAY BE favored by natural or man-made
environments
Mutations can lead to unique traits and are the raw material of
evolution by _________ _________.
natural selection
a strain of any cell or virus differing from parental
strain in genotype
Mutant
Typically refers to strain isolated from nature
Wild-type strain
structurally similar to normal
nitrogenous bases, but incorporate into DNA in place of a normal base and cause mistakes in base pairing
Nucleoside analog
Which type of mutation doesn’t
affect the activity of the product?
– Degeneracy of the genetic code
– Doesn’t change the amino acid sequence of resulting protein
Silent (Neutral) mutation
How do photolyases and nucleotide excision repair uv -induced damage?
- photolyases: use light to separate thymine dimers
- nucleotide excision repair: cuts out incorrect bases
- What happens in Missense mutation?
- What happens in Nonsense mutation?
- Base substitution results in change in an amino acid
- Base substitution results in a nonsense (stop) codon (UAA, UGA, UAG)
- where do point mutations occur?
- T or F point mutations can have varying effects
- occur at a single nucleotide
- True
Which mutations are the most
detrimental and result in different or defective proteins?
Frameshift mutations (both additions or deletions)
Which type of mutation causes change in only one base of DNA and can lead to single amino acid change in a protein, or no change at all?
Base substitution (point mutation)
Define frameshift mutation
Insertion or deletion of one or more nucleotide pairs
- result in shift of reading frame
___________: addition of 1 base causes a frame shift
____________: removal of 1 base causes a frame shift
Normal: THE CAT RAN BUT THE DOG DID NOT
____________: ATH ECA TRA NBU TTH EDO GDI DNO T
Normal: THE CAT RAN BUT THE DOG DID NOT
_____________: HEC ATR ANB UTT HED OGD IDN OT
Insertion
deletion
insertion
deletion
what are the 3 types of plasmids?
- Resistance (R) factor plasmid
- Conjugative plasmid
- Dissimilation plasmids
What 2 structures found are known as mobile genetic elements (move from one cell to another or from one chromosome to another)
What type of organisms does this occur in?
Plasmids and Transposons
Prokaryotic & Eukaryotic
What are self-replicating circular pieces of DNA, found in
bacteria?
Plasmids
- Which plasmid encodes antibiotic resistance, sometimes to multiple
different antibiotics? - what do conjugative plasmids carry for sex pili and transfer of the plasmids?
- what do dissimilation plasmids encode
enzymes for?
- Resistance (R) factor plasmid
- genes
- catabolism of unusual compounds
Define Resistance (R) factor plasmids:
plasmids that encode antibiotic
resistance; some can be transferred horizontally
Segments of DNA that can move
from one region of DNA to another
What do transposons contain that code for transposase?
What is the function of transposase?
Transposons
Insertion sequences
cut and reseal DNA
Define recalcitrant
distinguished ability to resist change in some property
- who/which experiment first demonstrated transformation and with what bacteria?
- what did this process set the stage for?
- Fredrick Griffith’s experiment (Late 1920’s), Streptococcus pneumoniae
- discovery of DNA
____________: return the environment altered by contaminants to its original condition
Bioremediation
- How does transformation occur (naturally or artificially) among several bacteria genera?
- what are competent cells?
- occurs naturally
- cells that are capable of taking up DNA and being transformed
Plasmids are transferred from one bacterium to another through cell-to-cell contact. What is this known as?
Conjugation in Bacteria
CONJUGATION in Bacteria
What do gram- bacteria use for attachment and transfer?
- how is it encoded?
In gram+ bacteria what holds participating cells together?
sex pili
- encoded by conjugative plasmid
a sticky substance
- T or F in conjugation cells must be opposite mating types
- who carries conjugative plasmid (F
factor) and can produce sex pili? - Does the donor (f+, male) or recipients (f-, female) lack the conjugative plasmid
- After conjugation the recipient (F- ) will become what?
- True
- Donor or F+ cell or Male
- Recipient or F- cell or Female:
- F+
Define Hfr cells
What do Hfr cells contain?
High frequency cells
F factor integrated into the
chromosome
Movement of genetic information between more or less
distantly related organisms, and thus stands in distinction
to the standard vertical transmission of genes from parent
Horizontal/Lateral gene transfer (HGT)
in transduction, DNA is transferred from a
bacterial donor cell to a recipient via a
what? (a virus that infects bacteria)
bacteriophage
- _____________ transduction:
RANDOM bacterial DNA is
packaged inside a phage and
transferred to a recipient cell - _________________ transduction:
SPECIFIC bacterial genes are
packaged inside a phage and
transferred to a recipient cell
- generalized transduction
- specialized transduction
