4.4 Translation

Question 1

Translate the amino acid sequence: GCACTACGGGTTTCTTTCCATT

Answer 1

Met, pro, lys, glu, arg, STOP

Question 2

What is the role of mRNA?

Answer 2

Contains the message/code for the amino acid sequence

Question 3

What is the role of tRNA?

Answer 3

Transfers amino acids and contains anticodons that pair with mRNA codons to put amino acids in the correct order

Question 4

What is the role of rRNA?

Answer 4

Matching mRNA and tRNA to synthesize proteins

Question 5

What is a mutation?

Answer 5

A change in the base sequence in a molecule of DNA

Question 6

What are the two different types of mutations?

Answer 6

Point mutation and frameshift mutation

Question 7

What is a point mutation?

Answer 7

The substitution of a single base

Question 8

What is a frameshift mutation?

Answer 8

Insertions and deletions, a shift in the reading frame

Question 9

What are the three types of point mutations and what do they mean?

Answer 9

Silent mutation has no effect on the amino acid sequence, missense mutation changes the amino acid sequence, nonsense mutation stops making the protein early