Tagnawa BSWR (Biochemistry) Flashcards
A newly married African American couple, both from families having histories of good health, are about to have a child. If the incidence of the sickle cell trait is approximately 1 1⁄2 among persons of African descenta in the United States, what is the chance that they will give birth to a child that is affected by sickle cell disease?
a. 1/12
b. 1/24
c. 1/96
d. 1/288
e. 1/576
e. 1/576
A 25-year-old African-American male with sickle cell anemia, who has been hospitalized several times from painful sickle cell crises, has successfully been free of these crises since he has been on hydroxyurea therapy. Treatment with hydroxyurea results in which of the following?
a. An increase in the oxygen affinity of HbS
b. An increase in the levels of hemoglobin F (HbF) in red blood cells
c. A decease cooperatively in oxygen binding by HbS
d. A posttranslational modification of HbS that prevents polymerization
e. A decreased ability of HbS to bind 2,3-biphosphoglycerate (2,3-BPG)
b. An increase in the levels of hemoglobin F (HbF) in red blood cells
A pregnant woman is able to transfer oxygen to her fetus because fetal hemoglobin has a greater affinity for oxygen than does adult hemoglobin. Why is the affinity of fetal hemoglobin for oxygen higher?
a. The tense form of hemoglobin is more prevalent in the circulation of the fetus
b. There is less 2,3-BPG in the fetal circulation as compared to maternal circulation
c. Fetal hemoglobin binds 2,3-BPG with fewer ionic bond than the adult form
d. The Bohr effect is enhanced in the fetus
e. The oxygen-binding curve of fetal hemoglobin is shifted to the right
c. Fetal hemoglobin binds 2,3-BPG with fewer ionic bond than the adult form
Influenza virus is a class Vb virus, which means that it has a single (–)- stranded RNA for its genome. Which of the following best describes the immediate fate of this (–)-RNA when the virus enters the host cell?
a. It is used directly to encode viral proteins.
b. It is used as a template to synthesize a (+)-strand viral messenger RNA (mRNA).
c. It is used as a template to synthesize viral DNA.
d. It is converted to a provirus.
e. It is integrated into the host cell genome.
b. It is used as a template to synthesize a (+)-strand viral messenger RNA (mRNA).
If a double-stranded DNA molecule undergoes two rounds of replication in an in vitro system that contains all of the necessary enzymes and nucleoside triphosphates that have been labeled with 32P, which of the following best describes the distribution of radioactivity in the four resulting DNA molecules?
a. Exactly one of the molecules contains no radioactivity.
b. Exactly one of the molecules contains radioactivity in only one strand.
c. Two of the molecules contain radioactivity in both strands.
d. Three of the molecules contain radioactivity in both strands.
e. All four molecules contain radioactivity in only one strand.
c. Two of the molecules contain radioactivity in both strands.
A 48-year-old man has had a lengthy history of skin cancer. In the past 6 years he has had over 30 neoplasms removed from sun-exposed areas and has been diagnosed with xeroderma pigmentosum. Which of the following best describes the enzymatic defect in patients with xeroderma pigmentosum?
a. DNA polymerase α
b. DNA polymerase γ
c. DNA ligase
d. Excision repair enzymes
e. RNA polymerase III
d. Excision repair enzymes
A 44-year-old woman who recently lost her job because of absenteeism, presents to her physician complaining of loss of appetite, fatigue, muscle weakness, and emotional depression. The physical examination reveals a somewhat enlarged liver that feels firm and nodular, and there is a hint of jaundice in the sclerae and a hint of alcohol on her breath. The initial laboratory profile included a hematological analysis that showed that she had an anemia with enlarged red blood cells (macrocytic). A bone marrow aspirate confirmed the suspicion that she has a megaloblastic anemia because it showed a greater than normal number of red and white blood cell precursors, most of which were larger than normal. Further analyses revealed that her serum folic acid level was 2.9 ng/mL (normal = 6 to 15), her serum B12 level was 153 pg/mL (normal = 150 to 750), and her serum iron level was normal. The patient’s megaloblastic anemia is most likely caused by which of the following?
a. A decreased synthesis of methionine
b. A decreased conversion of dUMP to dTMP
c. A decrease in the synthesis of phosphatidyl choline
d. A decrease in the levels of succinyl CoA
e. A decreased synthesis of dUTP
b. A decreased conversion of dUMP to dTMP
A patient presents with a urinary tract infection and is prescribed a combination drug containing trimethoprim and sulfamethoxazole. These drugs are effective because they do which of the following?
a. Bind to operons to prevent synthesis of bacterial mRNA
b. Block transport across bacterial cell walls
c. Inhibit bacterial synthesis of cobalamin (B12)
d. Inhibit bacterial synthesis of THF
e. Inhibit synthesis of phospholipids in bacteria
d. Inhibit bacterial synthesis of THF
Methotrexate is often used as a chemotherapeutic agent to treat patients with leukemia. This drug is effective because it inhibits cells in which part of the cell cycle?
a. G1 phase
b. S phase
c. M phase
d. G2 phase
e. G0 phase
b. S phase
Leukemia patients are often given the compound Leucovorin (N5-formyl THF) following treatment with the drug methotrexate. Why is leucovorin useful as part of this treatment protocol?
a. It facilitates the uptake of methotrexate by cells
b. It can be converted to THF by bypassing DHFR
c. It acts as an activator of thymidylate synthase
d. It prevents the uptake of methotrexate by normal cells
e. It stimulates cells of the immune system
b. It can be converted to THF by bypassing DHFR
Because of the close interrelationship between the vitamins, patients with deficiencies of either folate or vitamin B12 exhibit similar symptoms. Which of the following tests would best help distinguish between a folate and vitamin B12 deficiency?
a. Activity of methionine synthase
b. Blood level of cystathionine
c. Blood level of homocysteine
d. Blood level of methionine
e. Blood level of methylmalonate
e. Blood level of methylmalonate
A muscular 25-year-old male presents with dermatitis and an inflamed tongue. A history reveals that he has been consuming raw eggs as part of his training regimen for the past 6 months.
a. Ascorbic acid (vitamin C)
b. Biotin
c. Cobalamin (vitamin B12)
d. Folic acid
e. Niacin (vitamin B3 )
f. Pantothenic acid
g. Riboflavin (vitamin B2 )
h. Thiamine (vitamin B1 )
b. Biotin
A 30-year-old male goes to his dentist complaining of loosening teeth. Examination also reveals his gums are swollen, purple, and spongy. The dentist also notes that the patient’s fingers have multiple splinter hemorrhages near the distal ends of the nail and that a wound on the patient’s forearm has failed to heal properly.
a. Ascorbic acid (vitamin C)
b. Biotin
c. Cobalamin (vitamin B12)
d. Folic acid
e. Niacin (vitamin B3 )
f. Pantothenic acid
g. Riboflavin (vitamin B2 )
h. Thiamine (vitamin B1 )
a. Ascorbic acid (vitamin C)
A female neonate is found to have a small spina bifida in her lower spinal column that could affect bladder and lower limb function.
a. Ascorbic acid (vitamin C)
b. Biotin
c. Cobalamin (vitamin B12)
d. Folic acid
e. Niacin (vitamin B3 )
f. Pantothenic acid
g. Riboflavin (vitamin B2 )
h. Thiamine (vitamin B1 )
d. Folic acid
The current therapeutic strategy for patients who have been infected with HIV is a multidrug regimen known as highly active antiretroviral therapy (HAART). One type of drug used in this therapy is a nucleoside/ nucleotide analog, such as didanosine. Which of the following best describes the mechanism of action of these drugs?
a. They inhibit the synthesis of viral proteins.
b. They directly bind to and inhibit reverse transcriptase.
c. They prevent the hydrolysis of the viral polyprotein.
d. They prematurely terminate the DNA synthesized by reverse transcriptase
e. They inhibit the viral enzyme integrase
d. They prematurely terminate the DNA synthesized by reverse transcriptase
Given the mRNA nucleotide sequence, choose the best protein sequence that will likely result. (Use the amino acid table in Questions [13.2] and [13.3] in Case 13, keeping in mind that [T] and [U] are analogous).mRNA5ʹ′AUCGGAUGUCUCGGGUUCUGUAAAGGUAA UC 3ʹ′
a. Met-Ser-Arg-Val-Leu
b. Ser-Arg-Val-Leu
c. Met-Leu-Ser-Val
d. Ser-Arg-Val-Phe-Phe e. Pro-Ser-Val-Gly
a. Met-Ser-Arg-Val-Leu
One of the steps in the PCR amplification of DNA fragments is the denaturation step in which the temperature is raised to break the hydrogen bonds that make up the base pairing. Which of the following DNA fragments would most likely require the greatest increase in temperature to cause complete denaturation?
a. 5ʹ′-C-A-A-T-G-T-A-A-T-T-G-C-A-T-3ʹ′
3ʹ′-G-T-T- A-C-A-T-T-A-A-C-G-T-A-5ʹ′
b. 5ʹ′-A-T-A-T-A-T-A-T-A-T-A-T-A-T-3ʹ′
3ʹ′-T- A-T- A-T-A-T-A-T-A-T-A-T-A-5ʹ′
c. 5ʹ′-A-A-C-C-G-G-A-C-C-G-C-G-A-T-3”
3ʹ′-T- T-G-G-C-C-T-G-G-C-G-C-T-A-5ʹ′
d. 5ʹ′-A-G-A-G-A-G-A-G-A-G-A-G-A-G-3ʹ′
3ʹ′-T-C-T-C-T-C-T-C-T- C-T-C-T-C-5ʹ′
e. 5ʹ′-G-A-C-T-G-T-A-A-T-A-C-G-A-T-3ʹ′
3ʹ′-C-T-G-A-C-A-T-T-A-T-G-C-T-A-5ʹ′
c. 5ʹ′-A-A-C-C-G-G-A-C-C-G-C-G-A-T-3”
3ʹ′-T- T-G-G-C-C-T-G-G-C-G-C-T-A-5ʹ′
Restriction enzymes are used to cleave genomic DNA into smaller fragments. Which of the following single-strand DNA sequences has the best potential to be a site of action for a restriction endonuclease?
a. T–A–G–C–T–T
b. C–T–G–C–A–G
c. A–A–C–C–A–A
d. G–T–G–T–G–T
e. A–A–A–C–C–C
b. C–T–G–C–A–G
A 21-year-old woman was abducted when she went to the local convenience store. Her body was found the next morning in a wooded area behind the store. The autopsy revealed that she had been sexually assaulted and strangled. Crime scene investigators were able to collect a semen sample from vaginal fluid as well as tissue samples from underneath the victim’s fingernails. DNA samples were obtained from three suspects besides the victim. A variable number of tandem repeats (VNTR) analysis was performed on the DNA samples from the evidence collected, the victim, and the suspect, and the results were compared. Which of the following techniques is the most appropriately applied for this analysis?
a. Allele-specific oligonucleotide probes
b. DNA sequencing
c. Northern blot
d. Southern blot
e. Western blot
d. Southern blot
The thyroid hormones T3 and T4 are synthesized in the follicular cells of the thyroid gland. From which of the following essential amino acids are the thyroid hormones synthesized?
a. Isoleucine
b. Lysine
c. Methionine
d. Phenylalanine
e. Valine
d. Phenylalanine
The thyroid hormones T3 and T4 bind to the thyroid hormone receptor (THR) in the target cells. Which of the following mechanisms best describes the role of the THR?
a. It activates adenylyl cyclase to produce cAMP.
b. It activates the phosphoinositide cascade.
c. It is a soluble guanylyl cyclase.
d. It is a tyrosine kinase.
e. It is a transcription factor.
e. It is a transcription factor.
A 26-year-old male presents complaining of heat intolerance, heavy sweating, tremulousness, and feeling “jittery inside.” Physical examination reveals reddened conjunctiva and warm and moist palms, but the thyroid gland was not visibly enlarged. Which of the following tests would be most helpful to obtain an accurate diagnosis?
a. Electrocardiogram
b. Free thyroxine level
c. Serum cortisol levels
d. Serum electrolytes
e. Serum glucose level
b. Free thyroxine level
A 30-month-old female child whose growth rate has been in the lower 10th percentile over the last year presents with chronic, nonproductive cough and diarrhea with foul-smelling stools. She is diagnosed as having cystic fibrosis. For which of the following vitamins is this child most likely to be at risk of deficiency?
A. Ascorbic acid (vitamin C)
B. Biotin
C. Folic acid
D. Retinol (vitamin A)
E. Riboflavin (vitamin B2 )
D. Retinol (vitamin A)
Some forms of genetic diseases such as cystic fibrosis and sickle cell anemia can be diagnosed by detecting restriction fragment length polymorphisms (RFLPs). Which of the following is most likely to be used in an RFLP analysis?
a. Dideoxynucleotides
b. Mass spectrometry
c. Northern blot
d. Southern blot
e. Western blot
d. Southern blot
Your patient has been diagnosed with cystic fibrosis and has been determined to have the most common mutation, the ΔF508 gene. Which of the following is the most cost- and time- effective method for testing family members to see who are carriers of the mutation?
a. Allele-specific oligonucleotide probe analysis
b. DNA fingerprinting analysis
c. DNA sequencingz
d. Restriction length fragment polymorphism analysis
a. Allele-specific oligonucleotide probe analysis
Transfer of the peptide from the peptidyl tRNA to the aminoacyl-tRNA and formation of a peptide bond.
a. Aminoglycosides
b. Chloramphenicol
c. Erythromycin
d. Gentamicin
e. Kanamycin
f. Lincosamides
g. Neomycin
h. Puromycin
i. Streptomycin
j. Tetracycline
B. Chlorampenicol
Binding of aminoacyl-tRNA in the A-site of the ribosomal complex
a. Aminoglycosides
b. Chloramphenicol
c. Erythromycin
d. Gentamicin
e. Kanamycin
f. Lincosamides
g. Neomycin
h. Puromycin
i. Streptomycin
j. Tetracycline
j. Tetracycline
Translocation of the peptidyl tRNA from the A-site to the P-site.
a. Aminoglycosides
b. Chloramphenicol
c. Erythromycin
d. Gentamicin
e. Kanamycin
f. Lincosamides
g. Neomycin
h. Puromycin
i. Streptomycin
j. Tetracycline
c. Erythromycin
The 6-year-old son of a migrant worker is brought to a clinic with chills, headache, nausea, vomiting, and sore throat. The examining physician notes a persistent grayish colored membrane near the tonsils. History reveals that the patient has not been immunized against diphtheria. Diphtheria toxin is potentially lethal in this unimmunized patient because it causes which of the following?
a. Inactivates an elongation factor required for translocation in protein synthesis
b. Binds to the ribosome and prevents peptide bond formation
c. Prevents binding of mRNA to the 60S ribosomal subunit
d. Inactivates an initiation factor
e. Inhibits the synthesis of aminoacyl-charged tRNA
a. Inactivates an elongation factor required for translocation in protein synthesis
Replication of a particular DNA sequence is noted to be under inhibitory control usually. However, when substance “A” is added, it binds to a repressor, rendering the repressor inactive and allowing transcription to occur. Which of the following terms describes agent “A”?
a. Histone
b. Operon
c. Polymerase
d. Transcriber
e. Inducer
e. Inducer
A 38-year-old woman, who works as an administrative assistant for a large company, opened a package and found a suspicious white powder. Analysis of the powder indicates that it contained traces of the bacterium Bacillus anthracis. The woman was treated with ciprofloxacin, an effective antibiotic. Ciprofloxacin’s mechanism of action is best described as an inhibition of which of the following?
A. Bacterial dihydrofolate reductase
B. Bacterial peptidyl transferase activity
C. Bacterial RNA polymerase
D. DNA gyrase
E. DNA polymerase III
D. DNA gyrase
The Rubenstein-Taybi syndrome (RTS) is a genetic disease that is characterized by distinctive facial features, broad thumbs, broad big toes, and mental retardation. The affected gene is CBP (CREB-binding protein gene), which codes for a transcriptional activator. The RTS phenotype is best expressed by a haploinsufficiency model, in which two functional copies of the gene are required to produce sufficient CBP for proper development. CBP has a histone acetyltransferase activity, which does which of the following?
A. Inhibits RNA polymerase II
B. Helps expose the promoters of genes
C. Inhibits the splicing of heterogeneous nuclear RNA (hnRNA) to messenger RNA (mRNA)
D. Prevents the addition of a poly-A tail to mRNA
E. Activates the formation of nucleosomes
B. Helps expose the promoters of genes
Acetylation and deacetylation of lysine residues on histone proteins provide one mechanism by which transcription can be activated or repressed. Which one of the histone proteins is least likely to participate in this process?
a. H1
b. H2A
c. H2B
d. H3
e. H4
a. H1
Hereditary retinoblastoma is a genetic disease that is inherited as an autosomal dominant trait. Patients with hereditary retinoblastoma develop tumors of the retina early in life, usually in both eyes. The affected gene (RB1) was the first tumor suppressor gene to be identified. Which of the following best describes the function of the protein encoded by the RB1 gene?
a. It binds transcription factors required for expression of DNA replication enzymes
b. It allosterically inhibits DNA polymerase.
c. It binds to the promoter region of DNA and prevents transcription.
d. It phosphorylates signal-transduction proteins
a. It binds transcription factors required for expression of DNA replication enzymes
Mutations in the tumor suppressor gene BRCA1 are transmitted in an autosomal dominant fashion. When a cell is transformed to a tumor cell in individuals who have inherited one mutant allele of this tumor suppressor gene, which of the following most likely occurs?
a. A transcription factor is over expressed.
b. Deletion or mutation of the normal gene on the other chromosome
c. Chromosomal translocation.
d. Gene duplication of the mutant gene
b. Deletion or mutation of the normal gene on the other chromosome
Women who inherit one mutant BRCA1 gene have a 60 percent chance of developing breast cancer by the age of 50. The protein produced by the BRCA1 gene has been found to be involved in the repair of DNA double-strand breaks. Which of the following processes is most likely to be adversely affected by a deficiency in the BRCA1 protein?
a. Removal of thymine dimers
b. Removal of RNA primers
c. Removal of carcinogen adducts
d. Homologous recombination
e. Correction of mismatch errors
d. Homologous recombination
Micawley Talltwin is a 7-year-old child star who is brought to his pediatrician by his parents after they noticed that he felt very fatigued. They also noted that his abdomen seemed to be enlarged. Examination reveals an enlarged spleen. Further history reveals that he has been taking vitamins and iron supplements over the last few months. Laboratory tests show a microcytic anemia and elevated iron levels in tissues. Which of the following conditions is most consistent with the findings in this patient?
a. Aplastic anemia
b. Cooley anemia
c. Pernicious anemia
d. Thalassemia major
e. Thalassemia minor
e. Thalassemia minor
Micawley Talltwin is a 7-year-old child star who is brought to his pediatrician by his parents after they noticed that he felt very fatigued. They also noted that his abdomen seemed to be enlarged. Examination reveals an enlarged spleen. Further history reveals that he has been taking vitamins and iron supplements over the last few months. Laboratory tests show a microcytic anemia and elevated iron levels in tissues.
After diagnosing Micawley Talltwin and ascertaining he is not agranulocytic, his physician prescribes subcutaneous infusion of deferroxamine, an iron chelator, and monitors him for several weeks. What is his condition most likely to be on reexamination?
a. Iron levels decrease, but he remains anemic.
b. Iron levels decrease, and anemia recovers.
c. He develops irreversible and severe agranulocytosis
d. Iron and vitamin C levels decrease.
a. Iron levels decrease, but he remains anemic.
An electrophoretic analysis of Micawley Talltwin’s hemoglobin indicates that although there is a decrease in the relative amount of the β-chain with respect to the α-chain, both the β- and the α-chains migrate at the same position as normal chains. Most likely his anemia is caused by which of the following?
a. A defect in an enzyme involved in heme synthesis
b. A point mutation in the coding region of the gene coding for the β-chain
c. A frameshift mutation in the coding region of the gene coding for the β-chain
d. A mutation in the promoter of the β-chain gene
e. A mutation in the structural gene of the β-chain
d. A mutation in the promoter of the β-chain gene
As a medical geneticist, you analyze Talltwin’s DNA and find that he is homozygous for thalassemia. Assuming the disease is autosomal recessive, what can you deduce about the genotype of Mr. and Mrs. Talltwin?
a. Dad Talltwin is a carrier of the disease, and Mom Talltwin is normal.
b. Mom Talltwin is a carrier of the disease, and Dad Talltwin is normal.
c. Dad Talltwin is homozygous, and Mom Talltwin is normal.
d. Mom Talltwin is homozygous, and Dad Talltwin is normal.
e. Both Mom and Dad Talltwin are carriers of the disease.
e. Both Mom and Dad Talltwin are carriers of the disease.
A 6-year-old boy visits his physician because his parents have noticed autistic behavior and speech problems. The mother’s family does have a history of mental retardation. Therefore, the physician suggested a genetic screen of the fragile X mental retardation 1 (FMR1) gene for fragile X syndrome. Polymerase chain reaction (PCR) revealed borderline fragile X syndrome. What situation most likely explains this result?
A. A complete loss of fragile X mental retardation protein (FMRP)
B. An FMR1 gene CGG repeat expansion of 60 with partial DNA methylation
C. An FMR1 gene CGG repeat expansion of 230 with minor DNA methylation
D. An FMR1 gene CGG repeat expansion of 280 with complete DNA methylation
C. An FMR1 gene CGG repeat expansion of 230 with minor DNA methylation
Phil Hardy has decided to train for an upcoming marathon. Nearing the age of 50, Phil figures that after he trains he should be able to maintain a 9 minute-per-mile pace, which would mean that he would finish the race in approximately 4 hours. Given that he would be adequately hydrating himself at the various water stations along the way, as he is about to finish the 26 mile 385 yard course, what is the primary fuel that his leg muscles would be using?
a. Fatty acids from the blood
b. Glycerol from the blood
c. Glycogen stored in muscle
d. Glucose from the blood
e. Ketone bodies from the blood
a. Fatty acids from the blood
A postoperative patient on intravenous fluids develops lesions in the mouth (angular stomatitis). Urinalysis indicates an excretion of 15 μg riboflavin/mg creatinine, which is abnormally low. Which of the following TCA cycle enzymes is most likely to be affected?
a. Citrate synthase
b. Isocitrate dehydrogenase
c. Fumarase
d. Malate dehydrogenase
e. Succinate dehydrogenase
e. Succinate dehydrogenase
After excessive drinking over an extended period of time while eating poorly, a middle-aged man is admitted to the hospital with “high output” heart failure. Which of the following enzymes is most likely inhibited?
a. Aconitase
b. Citrate synthase
c. Isocitrate dehydrogenase
d. α-Ketoglutarate dehydrogenase
e. Succinate thiokinase
e. Succinate thiokinase
A full-term female infant failed to gain weight and showed metabolic acidosis in the neonatal period. A physical examination at 6 months showed failure to thrive, hypotonia, small muscle mass, severe head lag, and a persistent acidosis (pH 7.0 to 7.2). Blood lactate, pyruvate, and alanine were greatly elevated. Treatment with thiamine did not alleviate the lactic acidosis. Which of the following enzymes is most likely deficient in this patient?
a. Alanine aminotransferase
b. Phosphoenolpyruvate carboxykinase
c. Pyruvate carboxylase
d. Pyruvate dehydrogenase
e. Pyruvate kinase
d. Pyruvate dehydrogenase
A 3-month-old male infant developed seizures and progressively worsened, showing hypotonia, psychomotor retardation, and poor head control. He had lactic acidosis and an elevated plasma pyruvate level, both more than seven times the normal amount. Pyruvate carboxylase activity was measured using extracts of fibroblasts and was found to be less than 1 percent of the normal level. Oral administration of which of the following amino acids would you recommend as the best therapy for this patient?
a. Alanine
b. Glutamine
c. Leucine
d. Lysine
e. Serine
b. Glutamine
A deficiency in thiamine (vitamin B1) would most likely lead to which of the following clinical manifestations?
a. A decrease in carboxylase enzyme activity
b. A decrease in serum lactate concentrations
c. A decrease in red blood cell transketolase activity
d. An increase in urinary methylmalonate
e. An increase in prothrombin time
c. A decrease in red blood cell transketolase activity
A 16-month-old girl was found to have ingested approimately 30 mL of an acetonitrile-based cosmetic nail remover when she vomited 15 minutes postingestion. The poison control center was contacted, but no treatment was recommended because it was confused with an acetone-based nail polish remover. The child was put to bed at her normal time, which was 2 hours postingestion. Respiratory distress developed sometime after the child was put to bed, and she was found dead the next morning.
Inhibition of which of the following enzymes was the most likely cause of this child’s death?
a. Cytochrome c reductase
b. Cytochrome oxidase
c. Coenzyme Q reductase
d. NADH dehydrogenase
e. Succinate dehydrogenase
b. Cytochrome oxidase
Which of the following best describes the reason for the latency of acetonitrile toxicity and why prompt treatment would have prevented this child’s respiratory distress and death?
a. Acetonitrile crosses the mitochondrial membrane slowly.
b. Acetonitrile induces hemolysis by inhibiting glucose 6-phosphate dehydrogenase.
c. Acetonitrile is only poorly absorbed by the intestinal system.
d. Complex IV of the electron transport system binds acetonitrile weakly.
e. Cytochrome P450 enzymes oxidize acetonitrile and slowly release cyanide
e. Cytochrome P450 enzymes oxidize acetonitrile and slowly release cyanide
Inhibition of oxidative phosphorylation by cyanide ion leads to increases in which of the following?
a. Gluconeogenesis to provide more glucose for metabolism
b. Transport of ADP into the mitochondria
c. Utilization of fatty acids substrates to augment glucose utilization
d. Utilization of ketone bodies for energy generation
e. Lactic acid in the blood causing acidosis
e. Lactic acid in the blood causing acidosis
Which of the following procedures best describes the emergency intervention for cyanide poisoning?
a. Decrease the partial pressure of oxygen
b. Treatment with nitrites to convert hemoglobin to methemoglobin
c. Treatment with thiosulfate to form thiocyanate
d. Use of Mucomyst (N-acetylcysteine) taken orally
b. Treatment with nitrites to convert hemoglobin to methemoglobin
Respiratory distress is induced on rotenone exposure because it inhibits the complex that catalyzes which of the following?
a. Electron transfer from NADH to coenzyme Q
b. Oxidation of coenzyme Q
c. Reduction of cytochrome c
d. Electron transfer from cytochrome c to cytochrome a1 /a3
e. Electron transfer from cytochrome a1 /a3 to oxygen
a. Electron transfer from NADH to coenzyme Q
The major metabolic consequence of perturbation of the electron transfer in mitochondria is which of the following?
a. Increased production of NADPH
b. Increased oxidation of NADH
c. Increased reduction of O2 to H2O
d. Decreased regeneration of NAD+
e. Decreased reduction of FAD
d. Decreased regeneration of NAD+
Laboratory data show a remarkably increased carboxyhemoglobin level in the blood. The best explanation for this finding is that CO has which of the following effects?
a. It increases the hydrogen ion concentration causing oxyhemoglobin to precipitate
b. It changes the valence state of iron in hemoglobin
c. It competitively displaces O2 from oxyhemoglobin
d. It converts myoglobin to carboxyhemoglobin at a rapid rate
e. It prevents transfer of O2 across the alveolar membranes
c. It competitively displaces O2 from oxyhemoglobin
Which of the following treatment strategies is the most effective remediation for CO poisoning?
a. Removal from CO source
b. Removal from CO source and administration of 100 percent O2
c. Administration of 5 to 7 percent CO2 to stimulate respiration followed by 100 percent O2
d. Administration of 5 to 7 percent CO2 to stimulate respiration
e. Removal from CO source and administration of 5 to 7 percent CO2 to stimulate respiration
b. Removal from CO source and administration of 100 percent O2
In addition to forming carboxyhemoglobin, the toxic effects of CO include inhibition of which of the following enzymes involved in oxidation-reduction reactions?
a. NADPH dehydrogenase
b. Coenzyme Q reductase
c. Cytochrome c reductase
d. Succinate dehydrogenase
e. Cytochrome oxidase
e. Cytochrome oxidase
A young and otherwise healthy student undergoing preparation for a simple surgical procedure was noticed to have an elevating temperature and respiratory rate with muscle rigidity following the onset of anesthesia using halothane and succinylcholine. Laboratory findings revealed elevated levels of calcium, hydrogen ion, pyruvate, and lactate. The diagnosis was malignant hyperthermia.
The muscle rigidity observed in this patient is most likely prompted by which of the following?
a. The patient’s fear of surgery
b. Increased levels of hydrogen ion, causing the muscles to become immobile
c. Increased Ca2+ levels in muscle tissue, triggering muscle contraction
d. Increased pyruvate and lactate, causing precipitation of muscle protein
e. Increased body temperature
c. Increased Ca2+ levels in muscle tissue, triggering muscle contraction
Rapidly elevating body temperature was observed in this patient. The underlying cause for this pyretic episode is which of the following?
a. Hypothalamic upward adjustment of body temperature set point in response to cold operating room temperature
b. Muscles producing heat from exertion of contraction heat
c. Uncoupling proteins allowing dissipation of the mitochondrial hydrogen ion gradient releasing energy as heat
d. Metabolism of fatty acids from lipid storage depots releasing heat
e. Elevated consumption of ATP to support muscle contraction releasing heat
c. Uncoupling proteins allowing dissipation of the mitochondrial hydrogen ion gradient releasing energy as heat
Which of the following best describes the mechanism of action of dantrolene in the treatment of MH?
a. Decrease of Ca2+ release
b. Reduction of body temperature with hypothalamic set temperature
c. Effect on mitochondrial ATP production
d. Nuclear transcription attenuation
e. Recoupling of the sodium and ATP channels
a. Decrease of Ca2+ release
Prior to a race, many marathon runners will try to increase their glycogen concentrations by loading up with foods with a high starch content, such as pasta. α-Amylase secreted by the pancreas will digest the starch into which of the following major products?
a. Amylose, amylopectin, and maltose
b. Glucose, galactose, and fructose
c. Glucose, sucrose, and maltotriose
d. Limit dextrins, maltose, and maltotriose
e. Limit dextrins, lactose, and sucrose
d. Limit dextrins, maltose, and maltotriose
A 3-month-old infant presents with hepatosplenomegaly and failure to thrive. A liver biopsy reveals glycogen with an abnormal, amylopectinlike structure with long outer chains. Which of the following enzymes would most likely be deficient?
a. α-Amylase
b. Branching enzyme
c. Debranching enzyme
d. Glycogen phosphorylase
e. Glycogen synthase
b. Branching enzyme
A 3-year-old Caucasian female presents with chronic diarrhea and a failure to thrive. Stools were oily. History reveals that she was breastfed and had no problems until she was weaned. Which of the enzymes would be expected to be deficient following stimulation with secretin?
a. Cholesteryl esterase
b. Gastric lipase
c. Hormone sensitive lipase
d. Lipoprotein lipase
e. Pancreatic lipase
e. Pancreatic lipase
A female infant appeared normal at birth but developed signs of liver disease and muscular weakness at 3 months. She had periods of hypoglycemia, particularly on awakening. Examination revealed an enlarged liver. Laboratory analyses following fasting revealed ketoacidosis, blood pH 7.25, and elevations in both alanine transaminase (ALT) and aspartate transaminase (AST). Administration of glucagon following a carbohydrate meal elicited a normal rise in blood glucose, but glucose levels did not rise when glucagon was administered following an overnight fast. Liver biopsy revealed an increase in the glycogen content (6 percent of wet weight).
In which of the following enzymes is a genetic deficiency most likely for this patient?
a. Branching enzyme
b. Debranching enzyme
c. Glucose-6-phosphatase
d. Glycogen synthase
e. Muscle phosphorylase
b. Debranching enzyme
A female infant appeared normal at birth but developed signs of liver disease and muscular weakness at 3 months. She had periods of hypoglycemia, particularly on awakening. Examination revealed an enlarged liver. Laboratory analyses following fasting revealed ketoacidosis, blood pH 7.25, and elevations in both alanine transaminase (ALT) and aspartate transaminase (AST). Administration of glucagon following a carbohydrate meal elicited a normal rise in blood glucose, but glucose levels did not rise when glucagon was administered following an overnight fast. Liver biopsy revealed an increase in the glycogen content (6 percent of wet weight).
To prevent the frequent episodes of hypoglycemia, which of the following dietary supplements would be most appropriate for this patient?
a. Casein (milk protein)
b. Fish oil
c. Fructose
d. Lactose
e. Uncooked cornstarch
e. Uncooked cornstarch
A 17-year-old male presents complaining of an inability to perform strenuous exercise without bringing on painful muscle cramps and weakness. He indicated that mild to moderate exercise resulted in no problems. When he was administered an ischemic exercise test, his serum lactate concentrations did not increase significantly. A deficiency in which of the following enzymes is most likely the cause of the patient’s muscle cramps?
a. Carnitine palmitoyl transferase II
b. Glucose-6-phosphatase
c. Glycogen phosphorylase
d. Glycogen synthase
e. Very long chain acyl-CoA dehydrogenase
c. Glycogen phosphorylase
A 23-year-old male has been vigorously working on the yard and begins to feel slightly light-headed from hypoglycemia. He drinks a can of soda and is aware of the competition for the glucose to be stored in his liver as glycogen versus used as energy in his muscles. What is the best explanation regarding the fate of the glucose in the soda?
a. The lower Km of hexokinase versus the Km of glucokinase will tilt the glucose toward glycolysis
b. The bolus of glucose via the soda will lead to a higher glucose level, inducing storage of the glucose into glycogen in the liver.
c. The muscle is using high levels of glucose, leading to an increased level of glucose 6-phosphate thus inhibiting glucokinase.
d. The glucose will be equally used by muscle for metabolism and liver for glycogen storage.
a. The lower Km of hexokinase versus the Km of glucokinase will tilt the glucose toward glycolysis
During an extended period of exercise, the enzymes involved in the glycolytic pathway in muscle tissue are actively breaking down glucose to provide the muscle energy. The liver, to maintain blood glucose levels, is synthesizing glucose via the gluconeogenic pathway. Which of the following enzymes involved in these pathways would be most likely to exhibit Michaelis–Menten kinetics, that is, have a hyperbolic curve when plotting substrate concentration versus velocity of the reaction?
a. Fructose-1,6-bisphosphatase
b. Hexokinase
c. Lactate dehydrogenase
d. Phosphofructokinase 1
e. Pyruvate kinase
c. Lactate dehydrogenase
A known alcoholic is found lying semiconscious at the botton of a stairwell with a broken arm by his landlady, who called an ambulance to take him to the emergency room. Initial laboratory studies showed a relatively large anion gap of 34 (normal = 9 to 15). His blood alcohol was elevated at 245 mg/dL (intoxication level = 150 to 300 mg/dL), and his blood glucose was 38 mg/dL (low normal). The patient’s large anion gap and hypoglycemia can best be explained by which of the following?
A. Decreased secretion of glucagon
B. Increased secretion of insulin
C. Increased urination resulting from the diuretic effect of alcohol
D. Inhibition of dehydrogenase enzymes by NADH
E. Inhibition of glycogenolysis by ethanol
D. Inhibition of dehydrogenase enzymes by NADH
A young man with normocytic anemia, jaundice, and splenomegaly was diagnosed as having RBC pyruvate kinase deficiency after a peripheral blood smear showed spiculated cells.
Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but intermediates above pyruvate in the glycolytic pathway build up slowing the pathway. Which of the following products may not be made in the appropriate amounts in the RBC because of the deficiency of pyruvate?
a. Glucose
b. Oxaloacetate
c. acetyl-CoA
d. Lactate
d. Lactate
A young man with normocytic anemia, jaundice, and splenomegaly was diagnosed as having RBC pyruvate kinase deficiency after a peripheral blood smear showed spiculated cells.
In the RBCs of the patient described above, which of the following would be expected?
a. ADP to ATP ratios would be elevated above normal.
b. NADP+ would increase relative to NADPH.
c. Ribulose 5-phosphate levels would decrease.
d. NADH to NAD+ ratios would decrease.
e. Methemoglobin levels would increase.
a. ADP to ATP ratios would be elevated above normal.
The glycolytic pathway is a multistep process by which glucose is broken down to a three-carbon metabolite. Some of the steps are listed below:
1. Conversion of 3-phosphoglycerate to 2-phosphoglycerate
2. Conversion of phosphoenolpyruvate to pyruvate
3. Conversion of glyceraldehyde 3-phosphate to 1,3- bisphosphoglycerate
4. Conversion of glucose to glucose 6-phosphate
5. Conversion of fructose 6-phosphate to fructose 1,6-bisphosphate
- Conversion of glucose to glucose 6-phosphate
- Conversion of fructose 6-phosphate to fructose 1,6-bisphosphate
- Conversion of glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate
- Conversion of 3-phosphoglycerate to 2-phosphoglycerate
- Conversion of phosphoenolpyruvate to pyruvate
A 22-year-old soldier collapses from dehydration during maneuvers in the desert and is sent to a military hospital. Prior to enlisting, a physician observed a high level of glucose in his urine during an examination. At first, he was not allowed to enlist because he was suspected of being a diabetic. Further tests, however, determined that his insulin level was normal. A glucose tolerance test exhibited a normal pattern. Laboratory tests following his dehydration episode repeat the previous findings, but further testing of the urine reveals that only D-glucose is elevated. Other sugars were not elevated. This patient’s elevated urinary glucose and his dehydration episode are caused by a deficiency in which of the following?
a. GLUT 2
b. GLUT 4
c. Insulin receptor
d. SGLT1
e. SGLT2
e. SGLT2
Kidney glucose transporter
Your patient is a 7-month-old baby girl, the second child born to unrelated parents. She did not respond well to breast-feeding and was changed entirely to a formula based on cow’s milk at 4 weeks. Between 7 and 12 weeks of age, she was admitted to the hospital twice with a history of screaming after feeding, but was discharged after observation without a specific diagnosis. Elimination of cow’s milk from her diet did not relieve her symptoms; her mother reported that the screaming bouts were worse after the child drank juice and that she frequently had gas and a distended abdomen. Analysis of a liver needle biopsy did not reveal any liver enzyme deficiencies. Overall, the girl is thriving (weight greater than 97th percentile) with no abnormal findings on physical examination.
If a biopsy of intestinal tissue were obtained from your patient and analyzed, which of the following would most likely be deficient or defective?
a. GLUT 2
b. GLUT 5
c. Isomaltase
d. Lactase
e. SGLT1
b. GLUT 5
A 24-year-old African-American female presents with complaints of intestinal bloating, gas, cramps, and diarrhea following a meal including dairy products. A lactose-tolerance test confirms your suspicion that she had a deficiency of lactase in her intestine. Which of the following dairy products could you recommend that would be least likely to cause her difficulties in the future?
a. Condensed milk
b. Cottage cheese
c. Ice cream
d. Skim milk
e. Yogurt
e. Yogurt
A patient with type I diabetes mellitus has fasting and postprandial blood glucose levels that are frequently above the normal range despite good compliance with his insulin therapy. He was referred to a dietician that specialized in diabetic patients. The patient was recommended to incorporate foods high in dietary fiber. Which of the following dietary fibers would be most helpful in maintaining a normal blood glucose level?
a. Cellulose
b. Hemicellulose
c. Lignins
d. Pectins
d. Pectins
Some individuals complain of flatulence following a meal plentiful in beans, peas, soybeans, or other leguminous plants. All legumes contain the oligosaccharides raffinose and stachyose that contain glycosidic linkages that are poorly hydrolyzed by intestinal enzymes but are good sources of energy for intestinal bacteria that convert these sugars to H2. Which of the following glycosidic bonds are contained in raffinose and stachyose and are not hydrolyzed by our intestinal enzymes but can be by intestinal flora?
a. Galactose (α1→6) glucose
b. Galactose (β1→4) glucose
c. Glucose (β1→2) fructose
d. Glucose (α1→4) glucose
e. Glucose (β1→4) glucose
a. Galactose (α1→6) glucose
Cellulose is the most abundant polysaccharide and is an important structural component of cell walls. Strict vegetarians consume a large amount of cellulose, but it is not a source of energy because it is indigestible by the human intestinal tract.
Cellulose is indigestible because it contains which of the following glycosidic bonds?
a. Galactose (β1→4) glucose
b. Galactose (β1→6) galactose
c. Glucose (α1→4) glucose
d. Glucose (β1→2) fructose
e. Glucose (β1→4) glucose
e. Glucose (β1→4) glucose
A 27-year-old man has been rushed to the emergency room following his sudden collapse and entry into a state of unconsciousness. Examination of personal belongings revealed the patient is an insulin-dependent diabetic.
A rapid decline in which of the following humoral factors likely triggered the sudden collapse of the patient?
a. Insulin
b. Glucagon
c. Fatty acids
d. Glucose
e. Triglyceride
d. Glucose
Which of the following is least likely to contribute to the hyperglycemia associated with uncontrolled type I diabetes?
a. Decreased skeletal muscle glucose uptake
b. Decreased adipose lipogenesis
c. Increased adipose lipolysis
d. Increased hepatic gluconeogenesis
e. Increased skeletal muscle glycogenolysis
e. Increased skeletal muscle glycogenolysis
Which of the following changes in hepatic metabolism best explains the increased incidence of ketoacidosis observed in type I diabetes?
a. Increased glucose uptake
b. Increased protein synthesis
c. Increased lipoprotein synthesis
d. Increased B-oxidation
e. Increased glycogen breakdown
d. Increased B-oxidation
A middle-aged man, after an episode of retrosternal chest pressure with radiation to the neck and associated nausea and diaphoresis while at rest, was given a diagnosis of unstable angina and possibly myocardial infarction. Subsequent laboratory findings of increased serum levels of troponin I and cardiac enzymes were consistent with the diagnosis.
If the patient described above did indeed have angina, which of the following change(s) in metabolism in the affected area would occur?
a. Increased oxidative phosphorylation
b. Increased rate of fatty acid oxidation
c. Increased conversion of pyruvate to acetyl-CoA
d. Increased formation of lactate
e. Increased use of ketone bodies
d. Increased formation of lactate
A middle-aged man, after an episode of retrosternal chest pressure with radiation to the neck and associated nausea and diaphoresis while at rest, was given a diagnosis of unstable angina and possibly myocardial infarction. Subsequent laboratory findings of increased serum levels of troponin I and cardiac enzymes were consistent with the diagnosis.
In the case described above an ischemic episode very likely occurred. What changes in glucose metabolism would be observed?
a. The overall rate of glucose utilization would decrease.
b. Pyruvate kinase is allosterically inhibited.
c. The rate of ATP production in the cytosol increases.
d. NADH is reoxidized to NAD+via the glycerol 3- phosphate shuttle.
c. The rate of ATP production in the cytosol increases.
If the patient described does indeed have angina, his is a focal lesion wherein only one portion of heart muscle is affected while other portions still receive adequate oxygen enabling the malate-aspartate shuttle to function. Which of the following is involved in this shuttle to transfer electrons across the mitochondrial barrier?
a. Malate-aspartate antiporter
b. Malate-a-ketoglutarate antiporter
c. Glutamate-a-ketoglutarate antiporter
d. Aspartate-a-ketoglutarate symporter
e. Malate-glutamate symporter
b. Malate-a-ketoglutarate antiporter
A couple is seen in your office for genetic counseling regarding Tay-Sachs disease. They are very knowledgeable and request more information about the specific enzyme that is defective in this disease. You explain that Tay-Sachs results from the lack of an enzyme activity necessary for which of the following?
a. Removal of N-acetylgalactosamine from ganglioside GM2
b. Addition of N-acetylgalactosamine to ganglioside GM2
c. Removal of the disaccharide galactose-N-acetylgalactosamine from ganglioside GM2
d. Addition of the disaccharide galactose-N-acetylgalactosamine to ganglioside GM2
e. Removal of a galactose residue from ganglioside GM2
a. Removal of N-acetylgalactosamine from ganglioside GM2
Tay-Sachs disease involves the metabolism of gangliosides. Gangliosides are composed of a ceramide backbone with at least which one of the following?
a. Phosphorylated sugar residue
b. Glucose residue
c. Galactose residue
d. Sialic acid residue
e. Fructose residue
d. Sialic acid residue
The genetic disease which results from a mutation in the gene coding for the enzyme hexosaminidase (b-N-acetylhexosaminidase) is called what?
a. Huntington disease
b. Lesch-Nyhan syndrome
c. Tay-Sachs disease
d. Amyotrophic lateral sclerosis
e. Neurofibromatosis
c. Tay-Sachs disease
A 5-year old boy is seen by a pediatrician because his parents are concerned about his aggressive behavior, hyperactivity, and a loss of language skills. He also has recently become increasingly unsteady on his feet and has experienced a recent seizure. Slight facial feature coarsening is noted. In which of the following processes is this child most likely to have a disorder?
a. Mobilization of glycogen
b. Gluconeogenesis
c. Salvage of purine bases
d. Degradation of glycosaminoglycans
e. Cholesterol metabolism
d. Degradation of glycosaminoglycans
The patient is exhibiting the classic symptoms of Sanfilippo syndrome, which is a deficiency in one of four different lysosomal enzymes that breakdown glycosaminoglycans leading to the buildup of heparan sulfate and dermatan sulfate in lysosomes.
A15-month old white female is brought to the pediatrician because of recurrent upper respiratory tract infection. During physical exam the girl is noted to have a short stature, some clouding of the corneas, coarse facial features, and an enlarged tongue. She also appears to have some hearing loss and other developmental delays. The pediatrician suspects the child has a mucopolysaccharidosis. Which of the following is she least likely to have?
a. Hurler syndrome (MPS I)
b. Hunter syndrome (MPS II)
c. Morquio syndrome (MPS IV)
d. Sly syndrome (MPS VII)
e. Sanfilippo syndrome (MPS III)
b. Hunter syndrome (MPS II)
A 3-year-old male with coarse facial features, progressive loss of motor skills, hepatosplenomegaly and chronic diarrhea is suspected of having Hunter syndrome (MPS II). Which of the following monosaccharide residues would be expected to be found at the nonreducing end of glycosaminoglycans in this patient’s urine?
a. N-Acetylglucosamine
b. N-Acetylgalactosamine
c. Glucuronate
d. Iduronate
e. Iduronate 2-sulfate
e. Iduronate 2-sulfate
A patient presents in your office with very high levels of serum cholesterol. After a series of tests, you conclude that the patient has high circulating levels of LDL cholesterol, but has normal levels of the liver LDL receptor. One possible explanation for this observation is which of the following?
a. The patient has a mutated form of apoprotein B-100
b. The inability to selectively remove cholesterol from the LDL complex
c. The absence of the enzyme lipoprotein lipase
d. Decreased levels of acyl-CoA: cholesterol acyltransferase
e. Altered phosphorylation of the LDL receptor
a. The patient has a mutated form of apoprotein B-100
A patient with hereditary type I hyperlipidemia presents with elevated levels of chylomicrons and VLDL triglycerides in the blood. The main function of the chylomicrons in circulation is to do which of the following?
a. Transport lipids from the liver
b. Transport dietary lipids from the intestine to target tissues
c. Transport cholesterol from IDL to LDL
d. Act as a receptor for triacylglycerols in the liver
e. Bind cholesterol esters exclusively
b. Transport dietary lipids from the intestine to target tissues
Free cholesterol can affect cholesterol metabolism in the body by inhibiting cholesterol biosynthesis. The step at which free cholesterol inhibits its biosynthesis is by inhibiting which of the following processes?
a. Cyclizing of squalene to form lanosterol
b. Reduction of 7-dehydrocholesterol to form cholesterol
c. Formation of mevalonate from hydroxymethylglutaryl-CoA
d. Kinase that phosphorylates hydroxymethylglutaryl-CoA reductase
e. Condensation of acetyl-CoA and acetoacetyl-CoA to form hydroxymethylglutaryl-CoA
c. Formation of mevalonate from hydroxymethylglutaryl-CoA
A patient presents in your office with very high levels of serum cholesterol. He states that he has tried to follow the diet and exercise regimen you gave him last year. You decide that this patient would benefit from a drug such as Lipitor (atorvastatin). This class of drugs is effective in treating hypercholesterolemia because it has what effect?
a. Stimulates phosphorylation of the b-hydroxy-b-methylglutaryl-CoA reductase enzyme
b. Decreases the stability of the b-hydroxy-b-methylglutaryl-CoA reductase protein
c. Binds cholesterol preventing it from being absorbed by the intestine
d. Directly prevents the deposition of cholesterol on artery walls
e. Inhibits the enzyme b-hydroxy-b-methylglutaryl-CoA reductase
e. Inhibits the enzyme b-hydroxy-b-methylglutaryl-CoA reductase
The modification to bile salts that increases the working pH range and amphipathic nature of bile salts is:
a. 7a-Hydroxylation
b. Dehydroxylation by intestinal bacteria
c. Esterification
d. Conjugation to taurine or glycine
d. Conjugation to taurine or glycine
A new drug called CT2033, a corticosteroid, has reached the clinical trial stage. This drug was designed to treat inflammation but seems to also cause an undesired side effect where there is disturbance of cholesterol and bile acid homeostasis. Which of the following is least likely to explain the side effects caused by CT2033?
a. It downregulates the expression of a hepatobiliary bile acid transporter gene.
b. It inhibits a hepatobiliary transporter protein decreasing bile acid secretion.
c. It competes with cholesterol for CYP7A1 binding.
d. It binds and inhibits pancreatic lipases.
d. It binds and inhibits pancreatic lipases.
A 53-year-old male patient with elevated levels of low-density lipoprotein (LDL) cholesterol, signs of premature cholesterol gallstone disease and substantially elevated triglycerides visited his physician for a follow-up to check his current status. The patient had received various statin, HMG-CoA-reductase inhibitors therapies for the past 2 years. However, after blood work done at this follow-up visit, complications had still not subsided. This patient has similar problems as two of his siblings. Which of the following best explains this patients dyslipidemia?
a. An influx of abnormal phospholipids in the gallbladder as a result of ileal disease.
b. A loss of HMG-CoA reductase function
c. A loss of CYP7A1 (cholesterol 7α-hydroxylase) function
d. Elevated levels of ACAT
c. A loss of CYP7A1 (cholesterol 7α-hydroxylase) function
The coxibs, including celecoxib (Celebrex), are a recently developed class of nonsteroidal antiinflammatory drugs (NSAIDs). The coxibs show anti-inflammatory actions without affecting platelet function. These effects of the coxibs are best attributed to selective inhibition of which of the following?
a. The cytosolic isozyme of phospholipase A2 (cPLA2)
b. The cyclooxygenase activity of the “basal” prostaglandin H synthase isozyme (PGHS-1)
c. The cyclooxygenase activity of the “inducible” prostaglandin H synthase isoform (PGHS-2)
d. The microsomal isozyme of prostaglandin E synthase (mPGES-1)
e. Prostacyclin (PGI2) synthase (PGIS)
c. The cyclooxygenase activity of the “inducible” prostaglandin H synthase isoform (PGHS-2)
Prostaglandins comprise a family of oxygenated lipid signaling molecules derived from polyunsaturated fatty acids such as arachidonic acid. They are involved in regulating a number of cellular processes. Some of the prostaglandins act to increase vasodilation and levels of cAMP in cells, whereas others increase vaso- and bronchoconstriction and smooth muscle contraction. In the conversion of arachidonic acid to prostaglandins, the oxygenation step is accomplished by the enzyme that synthesizes which of the following compounds?
a. Prostaglandin D2
b. Prostaglandin E2
c. Prostaglandin F2a
d. Prostaglandin H2
e. Prostaglandin I2
d. Prostaglandin H2
Signaling via prostanoids begins by interaction of the prostanoid with its receptor. The receptor involved is usually located in which part of the cell?
a. Plasma membrane of a cell near the cell making the prostanoid
b. Nucleus of a cell in a different organ from the cell making the prostanoid
c. Endoplasmic reticulum of the cell making the prostanoid
d. Lysosomes of a cell circulating in the blood
e. Golgi of a cell circulating in the blood
a. Plasma membrane of a cell near the cell making the prostanoid
An 18-year-old male with sickle cell anemia develops severe right upper-abdominal pain radiating to his lower right chest and his right flank 36 hours prior to admission to the ER. Twelve hours following the onset of pain, he began to vomit intractably. In the past year he has had several episodes of mild back and lower extremity pain that he attributed to mild sickle cell crises. He reported that the present pain was not like his usual crisis pain. He also reports that his urine is the color of iced tea and his stool now has a light clay color. On examination, his temperature is slightly elevated, and heart rate is rapid. He is exquisitely tender to pressure over his right upper abdomen. The sclerae of his eyes are slightly yellowish in color. What is the most likely cause of this patient’s symptoms?
a. A cholesterol-rich gallstone
b. A defect in the synthesis of bile acids
c. A defect in heme synthesis
d. A gallstone rich in calcium bilirubinate
e. A sickle cell crisis brought on by overexertion
d. A gallstone rich in calcium bilirubinate
A patient has been on combination statin and cholestyramine therapy to lower his serum cholesterol levels. Prior to any surgery, this patient would be well advised to be supplemented with which of the following?
a. Vitamin A
b. Vitamin B12
c. Vitamin C
d. Vitamin K
e. Linolenic acid
d. Vitamin K
A 17-year-old female, whose parents were first cousins, presents to a neurologist because of recurring seizures despite being on anticonvulsive therapy. Nodules that appeared to be fatty deposits were present on her Achilles tendon and several of her joints. Plasma cholesterol concentrations were elevated, and an assay of plasma sterols indicated elevated cholestanol. Cultured skin fibroblasts did not contain any sterol 27- hydroxylase activity. A diagnosis of cerebrotendinous xanthomatosis, a genetic disease inherited in an autosomal fashion, was made. A deficiency in sterol 27-hydroxylase would lead to a decrease in the synthesis of which of the following compounds?
a. Chenodeoxycholate
b. Cortisol
c. 1,25 Dihydroxycholecalciferol
d. Estradiol
e. Testosterone
a. Chenodeoxycholate
Which of the following compounds directly inhibits the expression of the HMG-CoA reductase gene?
a. Squalene
b. HMG-CoA
c. Lanosterol
d. Isopentenyl pyrophosphate
e. Cholesterol
e. Cholesterol
You decide to treat a patient who has very high levels of serum cholesterol with the statin drug Lipitor (atorvastatin). You know that this drug acts in the metabolic pathway leading to the synthesis of cholesterol. The substrate for the enzyme inhibited by the statin drugs is which of the following?
a. Acetoacetyl-CoA
b. HMG-CoA
c. Farnesol pyrophosphate
d. Isopentenyl pyrophosphate
e. Mevalonate
b. HMG-CoA
Which of the following vitamins can be used in high doses to treat hypercholesterolemia?
a. Niacin
b. Riboflavin
c. Pyridoxine
d. Folic acid
e. Thiamine
a. Niacin
A teenage boy presents with moderate to severe epigastric pain. Physical examination reveals extensive eruptive xanthomas and hepatosplenomegaly. A blood sample reveals milky plasma. Which of the following is the most likely lipoprotein to be elevated in this patient’s plasma?
a. Chylomicrons
b. Chylomicron remnants
c. HDL
d. IDL
e. LDL
a. Chylomicrons
