8.4 Study Guide Flashcards
What is are codons and anticodons?
Codon: A codon is a 3 letter sequence of nucleotides on mRNA that code for one amino acid.
Anticodon: A 3 letter sequence of nucleotides attached to tRNA that are complementary to, and pair with codons.
What is translation?
Translation is the process where mRNA helps to create proteins by bonding amino acids together.
What are stop and start codons?
Start codons are the codons that signal for the translation process to begin.
Stop codons are the codons that terminate the translation process and signal for the newly formed polypeptide chain to be cut.
What is a mutation?
A mutation is a change in the base sequence (order of A, T, C, and Gs) in a molecule of DNA.
What is the role of mRNA during translation?
Contains message/code for amino acid sequence.
What is the role of tRNA during translation?
Contains anticodons that pair with mRNA codons to put amino acids in the correct order.
What is the role of rRNA during translation?
Facilitates matching of mRNA and tRNA, joins amino acids to synthesize protein.
What is point mutation and what are the types of point mutation?
Point: substitution of a single base
Silent/synonymous mutation: substitutes a single base, but does not change the type of amino acid (changes 3rd base)
Missense: a change in a base that changes the amino acid (changes 1st base)
Nonsense: a change in the 1st base of a codon that prematurely codes for a stop sequence in the amino acid.
What is framshift mutation?
Insertions: add a base or bases and cause immediate nonsense
Deletion: deletes a base or bases and causes extensive missense
Shift in the reading frame, changes everything downstream. Insertion or deletion of 3 nucleotides: no frameshift; extra or missing amino acid.
Using the codon chart, translate this mRNA sequence into an amino acid sequence: AUUAUGGGAAAGGCACAUAGA
Met. Gly. Lys. Ala. His. Arg.
How can you identify different types of mutations?
Point mutations change a base in the codon. If this is a silent mutation, then the amino acid will stay the same. If it is a missense mutation, then the amino acid will change. If the mutation is a nonsense mutation, then a stop sequence will be put in place.
Frameshift mutations add or subtract bases. If a base or bases are added, then it causes nonsense. If a base or bases is deleted, then it causes missense. If 3 bases are inserted or deleted, then there is no frameshift and there is either an extra amino acid, or a missing amino acid.
What are positive and negative transcription factors?
Positive TF: A protein that binds to DNA and initiates the transcription of the gene. It signals to the RNA Polymerase to start the copying process.
Negative TF: A protein that binds to DNA and inhibits the transcription of the gene. It slows the transcription rate to a halt by signaling for the RNA Polymerase to stop the process.
How is protein production affected by positive and negative transcription factors?
With a higher concentration of positive transcription factors and a low concentration of negative transcription factors, more protein will be produced. More mRNA will be produced, which codes for the amino acid sequence. However, if there is a low concentration of positive transcription factors and a high concentration of negative transcription factors, then less protein will be produced. Less mRNA will be produced, so less amino acids can be bonded together, resulting in less protein.
How does affinity strength affect the production of protein?
A high positive transcription factor affinity, high RNA polymerase affinity, and low negative transcription factor affinity result in more protein being produced. The positive transcription factors and RNA polymerases would be more attracted to the DNA, which means that they would synthesize more mRNA, which can code for more proteins. However, if the affinity is low for positive transcription factors and RNA Polymerase, and is high for negative transcription factors, then less mRNA will be produce,d resulting in fewer proteins being produced.
