Lecture 5: Biological models Flashcards
wat is een alternatief voor nature vs nurture (want het is altijd nature en nurture)
ultimate vs proximal causes
causes die interacteren met de omgeving van ultimate naar proximaal
balancing selection
available resources
stress
parenting
attachment
social interactions
trauma
3 factoren van evolution via natural selection
- variation
- selection (adaptive differences)
- heritability
Do psychological mechanisms (relevant for MAPD) work in the same way? Dus door middel van evolutie?
To some extend: (negative) emotions, but not DSM diagnoses
Is there one ‘optimal’ adaptation?
No, it is all depends on the context, and changes in context and individual
differences: ‘smoke detector principle’
smoke detector principle =
The Smoke Detector Principle (SDP) explains why evolved systems that regulate protective responses often give rise to false alarms and apparently excessive responses.
The SDP describes the special case when the costs of a response are low, the costs of failing to express a needed response are large, and the presence of danger is uncertain.
smoke detector principle depends on…
- probability of an event
- false negative: the cost of missing a dangerous situation
- false positive: the cost of wrongly identifying something as dangerous
- changes in the environment
evolution figuur: welke onderdelen
punishment threshold & reward threshold
high punishment threshold =
not sensitive
low punishment threshold =
sensitive
reward threshold low =
sensitive
waar staan alle disorders hier
depressive disorders: links verticaal
anxiety disorders: onder horizontaal
dysphoric mania: rechts onder
euphoric mania: rechts boven
zie schrift
info over genes
- Nuclei contains chromosomes
- Chromosome consists of Deoxyribo Nucleic Acid
- DNA consists of sugar-phosphate backbone + “base-pairs”
- Genes = sequence base pairs: ACTGGGCTACTACACAAACC
- Genes (DNA) -> RNA -> proteins
- Mutations can occur, and these are heritable
- Only <2% of DNA are genes! - rest “junk” DNA?
-> No, rest of DNA can influence gene expression.. Epigenetics – environment influences gene expression
behavioural genetics methods:
- Family studies
- Adoption research
- Twin research
- Monozygotic (MZ); 100% genetical identical
- Dizygotic (DZ); on average 50% genetical identical
bij wie zijn de slopes meer stijl: MZ of DZ
MZ (want deze zijn meer alike)
dus wat als de correlatie tussen MZ sterker is dan DZ (stijler)
must be due to genetics!
= genes play an important role
op depressie rates zal dit verschil tussen MZ en DZ dus minder hoog zijn dan bij bv height
oke
mood and anxiety disorders: wat is de heritability hiervan?
partly heritable, partly unique experiences
wat is er lastig aan dat mood & anxiety beiden partly heritable zijn
the environment is also heritable!
- Marital quality
- Social support
- Parental discipline and warmth
- Family environment
- Peer relationships
wat zijn 3 verschillende interacties tussen genes and environments
- passive
- reactive (evocative)
- active
passive =
genotype van ouders leidt tot genotype van kind (waardoor gedrag van ouders lijkt op gedrag van kind)
reactive (evocative) =
genotype -> behaviour <-> environment
active =
genotype -> behaviour -> environment
hoe heten de interacties waarin genes -> environment
gene - environment correlations (rGE)
hoe heten de interacties waar environment -> genes
gene x environment interactions (GxE)
welk mechanisme is mogelijk onderliggend aan GxE
epigenetics
hoe werken epigenetics
genotype -> behaviour
epigenetics |
(dus epigenetics komt nog op het pijltje van genotype naar behaviour)
wat is de relatie tussen frequency & effect op psychiatrische stoornissen
genetic variation that occurs a lot, has a small effect (common variants)
rare alleles can have a large effect
low-frequency variants usually have an intermediate effect
wat is het replication problem
genetic variation that occurs a lot, has a smalle effect
anders zou dit niet kloppen met evolutie: negatieve effecten zouden niet vermeerderen
wat zie je aan het manhattan plot
all kinds of genes & chromosomes have an effect, it is not just one gene
wat zijn de conclusies van genes voor MAPD
- Partially heritable – replicated research (!)
…but do think about gene-environment correlations and interactions - Not related to a few genes, but polygenetic effects
- Unclear how the genetic mechanism works exactly, but increase in explained variance
welke areas zitten de 3 neurotransmitters
dopamine - ventral tegmental area
norepinephrine - locus coeruleus
serotonin - raphe nucleus
(= samen PFC)
which is the most important target for antidepressants
mono-amines (serotonine, dopamine, norepinephrine)
wat denken mensen over monoamines door de AD
dat depression een disorder van neurotransmitters is. nee!
-> the cause of a headache is not a lack of paracetamol. we dont even know if there is a disturbance. therefore this is not true. we also dont really know how antidepressants work (however, they are prescribed a lot)
hoe denken we dat SSRI’s werken
- SSRI = less (sensitive) Autoreceptors = more NT
- Neuroplasticity: SSRIs = more Brain Derived Neurotrophic Factor
- Hippocampus growth = better stress regulation
hoe kan je uitleggen dat artsen en researchers anders naar AD kijken
- effect size vergeleken met placebo = 0.3
- effect size niet vergeleken met placebo = 0.8
dus het werkt wel, dat zie je in practice, maar niet perse beter dan placebo!
wat hebben antidepressiva & placebo in gemeen, wat betreft de response?
- effect of clinical management
- expectations (placebo effect)
- natural course
- regression towards the mean
the placebo effect…
is real! not a biological active substance, but it does have a biological effect
open-labelled placebo might also work (But not as effective as psychotherapy)
oke
why has it taken so long to realise the caveats of AD
- study publication bias
- outcome reporting bias
- spin
study publication bias =
which studies were not published at all?
outcome reporting bias =
which (negativve studies) were published, but with suddenly positive results?
spin =
which (negative) trials were published with negative results, but somehow still concluded that the drug is effective?
wat is vooral het probleem met AD
the use of vs knowledge about the AD is not balanced, we know too little for how much we use them
critical conclusion 2
- Treatment response depends on likelihood of receiving a real drug
- Placebo-run in phases: selection of patients in clinical trials who don’t respond to placebo.
- Active placebo effect; larger AD-placebo difference when perceived being on active treatment.
- Effects of AD are only shown on short term.
- Side-effects can be severe
