Week 1: Dna Discovery And Basics

Question 1

Who first discovered ‘nuclein’ and in what year?

Answer 1

Friedrich Miescher in 1869

Nuclein later became known as nucleic acid, then deoxyribonucleic acid (DNA)

Question 2

What structures contain hereditary information as discovered by Walther Flemming in 1888?

Answer 2

Chromosomes

Chromosomes were named from the Greek for ‘coloured bodies’

Question 3

What did Phoebus Levene propose about nucleic acids in 1919?

Answer 3

Nucleic acids are composed of a series of nucleotides

Each nucleotide consists of a nitrogen-containing base, a sugar molecule, and a phosphate group

Question 4

What significant discovery did Oswald Avery make regarding DNA?

Answer 4

DNA specifically carries inherited information

This was demonstrated in experiments conducted in 1928 and 1944

Question 5

Who identified the double helix structure of DNA and in what year?

Answer 5

James Watson and Francis Crick in 1953

Question 6

What experimental work contributed to Watson and Crick’s model of DNA?

Answer 6

X-ray diffraction experiments by Rosalind Franklin and Maurice Wilkins

Question 7

What is the width of DNA?

Answer 7

2 nm

2 nm is equivalent to 2 x 10^-9 m

Question 8

What is the rise per base pair in the DNA double helix?

Answer 8

0.34 nm

Question 9

How many bases are there per turn in a typical DNA helix?

Answer 9

10 to 10.5 bases

Question 10

What are the three components of a nucleotide?

Answer 10

Deoxyribose sugar, phosphate group, base

The base can be one of four types: A, T, C, or G in DNA

Question 11

List the four types of bases in DNA.

Answer 11

• Adenine (A)
• Cytosine (C)
• Guanine (G)
• Thymine (T)

Question 12

What are the two categories of bases in DNA?

Answer 12

Purines and Pyrimidines

Question 13

Which bases are classified as purines?

Answer 13

• Adenine (A)
• Guanine (G)

Question 14

Which bases are classified as pyrimidines?

Answer 14

• Cytosine (C)
• Thymine (T)

Question 15

What type of bond holds the two strands of the DNA double helix together?

Answer 15

Hydrogen bonds between complementary base pairs

Question 16

What are the ‘Watson-Crick rules’ regarding base pairs?

Answer 16

A pairs with T (2 hydrogen bonds) and C pairs with G (3 hydrogen bonds)

Question 17

What does it mean for DNA strands to be ‘antiparallel’?

Answer 17

One strand runs 5’ to 3’ and the other runs 3’ to 5’

Question 18

What is the importance of the 5’ and 3’ ends in DNA?

Answer 18

They indicate the direction of synthesis during replication

Question 19

What is the sequence of bases in a DNA strand written from 5’ to 3’?

Answer 19

5’ - ACGTCGTAGCGTTACGACGAT - 3’

Question 20

What is the complementary sequence of the given DNA strand 5’ - ACGTCGTAGCGTTACGACGAT - 3’?

Answer 20

3’ - TGCAGCATCGCAATGCTGCTA - 5’

Question 21

Why is DNA structured as a double helix?

Answer 21

To save space, for replication, and for stability

Question 22

In what year did Crick, Watson, and Wilkins receive the Nobel Prize in Physiology or Medicine?

Answer 22

1962

Question 23

Fill in the blank: The sugar in DNA is known as _______.

Answer 23

Deoxyribose

Question 24

Fill in the blank: The bond formed between nucleotides is called a _______ bond.

Answer 24

Phosphodiester

Question 25

True or False: Rosalind Franklin received the Nobel Prize for her work on DNA.

Answer 25

False

Rosalind Franklin died in 1958 and did not receive the prize

Question 26

What is the function of the phosphate group in a nucleotide?

Answer 26

Provides structure to the nucleotide