Unit 3 Exam Flashcards
If the sequence of one strand of a DNA molecule is 5’ - CAGTACGACCTAA - 3’, the sequence of the complementary strand is _____.
3’ - GTCATGCTGGATT - 5’
The enzyme that inserts the correct bases in a growing nucleotide chain in a replicating DNA molecule is _____.
DNA polymerase
In DNA replication, _____.
The parental DNA splits and free nucleotides bond to their complements, building two DNA molecules from one
In a DNA molecule, the base pairs provide information, and the sugar-phosphate backbone does not, because _____.
The bases form a sequence, and the sugar-phosphate backbone does not
Which of the following is most correct regarding genes, DNA, and protein?
A gene is a section of DNA whose sequence encodes a particular protein, which is composed of amino acids
If the sequence of one strand of a DNA molecule is 5’ ATGGCAT 3’, the sequence of the complementary strand is _____.
3’ TACCGTA 5’
Watson and Crick based their conclusion that DNA is a double helix mainly on experimental results and measurements from _____.
Chargaff, Wilkins, and Franklin
The nitrogenous bases adenine and thymine are _____.
A purine and a pyrimidine, respectively
Frederick Griffith was a microbiologist who observed that _____.
Nonvirulent bacteria become virulent when mixed with heat-killed virulent bacteria
_____ used X-ray diffraction to deduce the helical shape of DNA.
Rosalind Franklin
Because DNA strands are antiparallel, DNA replication at a single replication fork proceeds _____.
Continuously on one strand and discontinuously on the other
_____ used models to deduce the double helical shape of DNA.
James Watson and Francis Crick
Hydrogen bonds are not as strong as ionic or covalent bonds, but they are able to hold the DNA double helix together because _____.
There are so many of them
Avery, MacLeod, and McCarty’s experiments built on the results of the experiments of _____.
Frederick Griffith
Human DNA can be replicated quickly because it has many _____.
Replication forks
Meselson and Stahl’s experiments showed that DNA replication is _____.
Semi-conservative, but not dispersive or conservative
DNA entwined around an octet of proteins is called a(n) _____.
Nucleosome
Miescher discovered phosphorus in DNA taken from _____.
Soiled bandages
In experiments to show that DNA is the genetic material, Hershey and Chase labeled DNA with radioactive _____.
Phosphorus
Chromatin consists of about _____.
30% histones, 30% DNA binding proteins, 30% DNA, and 10% RNA
A retrovirus produces an enzyme, called reverse transcriptase, which copies its RNA genome into DNA. This is opposite of the central dogma because _____.
The central dogma states that DNA is copied into RNA
A genetic code word is called a(n) _____.
Codon
A signal sequence _____.
Is the first few amino acids in a protein that will be secreted or lodge in a membrane
If part of a DNA template is the sequence GTTAGTCTGTGGGCT, then the mRNA transcribed from it is _____.
CAAUCAGACACCCGA
Which codon halts ribosomes?
UAG
A codon consists of three consecutive _____.
mRNA bases
Consider the following mRNA molecule:
AGGACAGCGGUUGGGCAACGUAAA.
The sequences below have nucleotides added or deleted. Which of the following sequences would NOT result in a frameshift from the original sequence?
AGGCCCACAGCGGUUGGGCAACGUAAA