Quiz 8 and 9 Questions Flashcards
Put the following steps of Rho-independent transcription termination in order:
Question 7 options:
The weak hydrogen bonding between the RNA and DNA at the six adenine sequence allows to RNA polymerase to fall off the DNA.
The sequence of six adenines are transcribed while the RNA molecule folds into a hairpin structure
The inverted repeat DNA sequences are transcribed
3, 2, 1
The E. coli RNA polymerase holoenzyme recognizes and binds the -35 consensus sequence of the promoter region.
Question 1 options:
False
True
True
During prokaryotic transcription, the -10 consensus sequence of the gene promoter is transcribed into RNA as the following sequence: UAUAAU.
Question 2 options:
True
False
False
Which eukaryotic RNA polymerase enzyme transcribes pre-mRNA ?
Question 3 options:
RNA polymerase III
RNA polymerase IV
RNA polymerase II
RNA polymerase I
RNA Pol II
An mRNA molecule will have the same sequence as the non-template DNA stand - with U instead of T - and be complimentary to the template strand.
Question 4 options:
True
False
True
RNA splicing in eukaryotes consists of the removal of the noncoding…… while joining together the……sequences that will make up the mature mRNA molecule.
Introns
Exon
mRNA is i)_________ (with U in place of T) to the non-template DNA strand and ii)_________ to the template DNA strand.
Question 6 options:
i) anti-parallel , ii) complementary
i) complementary , ii) identical
i) identical, ii) complementary
i) complementary , ii) complementary
identical
complementary
Given the following prokaryotic DNA sequence representing a typical E. coli promoter region, label the polarity of each strand. Number only.
’ACATGTAACTGTTGATGCGTAACTGCTACATATTATGAAGATGCC ’
’TGTACATTGACAACTACGCATTGACGATGTATAATACTTCTACGG ’
3’ to 5’
5’ to 3’
Given the two complementary DNA sequences below from an E. coli gene promoter region, match the following labels to the appropriate strand.
Question 9 options:
CGTGAACTGTTAATCTAGGTACAGCTACATATTAGTGAGAT
GCACTTGACAATTAGATCCATGTCGATGTATAATCACTCTA
- Non-template
- Template
Template
Non Template
What would be the first three nucleotides in the RNA sequence that would be transcribed from the following E. coli DNA sequence? NOTE: Use the appropriate letter to designate each nucleotide. Do not include spaces in your answer.
5’-TGCACTTGACAATTAGATCCATGTCGATGTATAATCCTCTGTATGC-3’
3’-ACGTGAACTGTTAATCTAGGTACAGCTACATATTAGGAGACATACG-5’
GUA (The +1 sequence, which is 5-8bp down from -10, first G/A)
Which of the following is NOT an example of the RNA processing that occurs in eukaryotes?
Addition of the poly-A tail
Splicing to remove introns
Splicing to remove exons
Addition of a 5’ methyl guanosine cap
Splicing to Remove Exons
The ribonucleoprotein structures which function in nuclear pre-RNA splicing are called:
Question 2 options:
Polymerases
Spliceosomes
Splicing ligases
Ribonucleases
Splicesomes
The region of DNA which contains sequences required for the initiation of transcription is called the:
Question 3 options:
Promoter
Initiation codon
OriC
Enhancer
Promoter
During prokaryotic transcription, the -10 consensus sequence of the gene promoter is transcribed into RNA as the following sequence: UAUAAU.
Question 4 options:
True
False
False
The three base-pair sequence found on tRNA, which complements and pairs with the mRNA codon during translation, is called..
UAC
During elongation of translation the in-coming aminoacyl-tRNA binds the ribosome at which site?
Question 2 options:
A
E
30s
P
A
In regards to the relationship between each amino acid and its corresponding tRNA molecule:
Question 5 options:
The amino acid is covalently bound to the 5’ end of the tRNA.
The amino acid is bound to the 3’ end of the tRNA via a peptide bond.
A bond is formed between the amino acid carboxyl group and the 3’ hydroxyl group on the tRNA.
The amino acid is bound to the anticodon of the tRNA.
A bond is formed between the amino acid carboxyl group and the 3’ hydroxyl group on the tRNA.
Put the following steps of polypeptide chain elongation in the correct order:
Question 8 options:
The appropriate incoming aminoacyl-tRNA bound with EF-TU and one molecule of GTP binds the A site of the ribosome, with the tRNA anti-codon pairing with the mRNA codon at this site.
This process is repeated until a STOP codon is present in the A site.
The peptidyl-tRNA moves from the A site to the P site while the uncharged tRNA in the P site is translocated to the E site as the ribosome moves three nucleotides down the mRNA.
A peptide bond is formed between the carboxyl end of the growing polypeptide chain and the amino group of the A site amino acid, transferring the polypeptide from the P site tRNA to the A site tRNA.
1, 4, 3, 2
While there are many similarities between the prokaryotic and eukaryotic ribosome, there are some notable differences. Match each statement below with the appropriate label; Prokaryotes, Eukaryotes, or Both.
Question 9 options:
The entire assembled ribosome consists of many ribosomal proteins and three distinct rRNA molecules.
The entire assembled ribosome consists of many ribosomal proteins and four distinct rRNA molecules.
Two smaller subunits assemble to produce the complete ribosome.
Prokaryotes, Eukaryotes, Both
