Chapter 9 Practice Problems

Question 1

a short DNA fragment that can be synthesized by a machine

Answer 1

oligonucleotide

Question 2

a DNA molecule used for transporting, replicating, and purifying a DNA fragment

Answer 2

vector

Question 3

short single stranded sequences found at the ends of many restriction fragments

Answer 3

sticky ends

Question 4

contains genetic material from two different organism

Answer 4

recombinant DNA

Question 5

DNA chain-terminating subunits

Answer 5

ddNTPs

Question 6

a collection of the DNA fragments of a given species, inserted into a vector

Answer 6

genome library

Question 7

the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specific organism

Answer 7

genomic equivalent

Question 8

method of separating DNA molecules by size

Answer 8

gel electrophoresis

Question 9

gene in a vector that enables isolation of transformants

Answer 9

selectable marker

Question 10

stable binding of a single stranded DNA molecules to each other

Answer 10

hybridization

Question 11

oligonucleotide extended by DNA polymerase during replication

Answer 11

primer

Question 12

synthetic DNA element in a cloning vector with unique restriction sites used for insertion of foreign DNA

Answer 12

polylinker

Question 13

the DNA molecule whose entire sequence follows is digested to completion with the enzyme EcoRI (5’ G^AATTC 3’). How many molecules of DNA would result from this reaction? write out the entire sequences of the resultant DNA molecules indicating all relevant 5’ to 3’ polarities. What about this problem appears unusual in relationship to DNA made of random nucleotide seqeucnes?
5’ AGATGAATTCGCTGAAGAACCAAGAATTCGATT 3’
3’ TCTACTTAAGCGACTTCTTGGTTCTTAAGCTAA 5’

Answer 13

three fragments; The original piece of DNA shown in this problem is much smaller than 4096 bp, so it would be unusual to find two recognition sites for EcoRI so close together.

Question 14

why do longer DNA molecules move more slowly than shorter ones during electrophoresis?

Answer 14

Smaller DNA fragments will find more holes through which they can travel, so they will move faster than larger DNA fragments, whose movements will be retarded when they bump into holes that are not large enough for them to go through.

Question 15

Agarose gels with different average pore sizes are needed to separate DNA molecules of different size classes. For example, optimal separation of 1100 bp and 1200 bp fragments would require a gel with a smaller average pore size than optimal separation of 8500 bp and 8600 bp fragments. How do you think that scientists prepare gels of different average pore sizes?

Answer 15

by using different concentrations of agarose

Question 16

consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount of a restriction enzyme for a vert short period of time

a. would the resultant fragments be longer or shorter or the same size as those produced by a complete digestion?
b. if you prepared genomic DNA from a tissue sample containing millions of cells, would the fragments produced by partial digestion of DNA from all of these cells be the same or different?

Answer 16

a. the partial digest would produce fewer fragments of longer average sizes than would be produced by digesting the same DNA sample to completion with the same enzyme.
b. The fragments of DNA produced from the genomes of different cells by partial restriction digestion would be different from each other

Question 17

The text stated that molecular biologists have developed elegant techniques that can convert any type of DNA end into any other type of DNA end. In this problem, consider genomic DNA that is broken by mechanical shearing into random pieces. Some of the ends of these pieces are blunt, some have 5’-overhangs, and others have 3’-overhangs

a. must the two ends of any one genomic DNA fragment be of the same type?
b. explain why the ends with 5’ or 3’ overhands are not sticky
c. researchers can convert ends with overhangs into blunt ends using either DNA polymerase, or nuclease S1, which decades single stranded regions of DNA but not double stranded regions. which kinds of ends with overhangs (5’ or 3’) could be converted into blunt ends using DNA polymerase? with S1 nuclease?

Answer 17

a. No; each of the two ends of a genomic DNA fragment that was broken by shearing was made by a different breakage event.
b. First, many of the fragments have blunt ends. Second, the fragments with overhangs do not all have the same kind of overhang; the overhangs can be any length, any base sequence, and either 5′ or 3′.
c. Only 5′ overhangs can be made blunt by DNA polymerase

Question 18

which of the enzymes from the following list would you need to make a recombinant DNA molecule? What is the function of those enzymes in the process?

a. DNA polymerase
b. RNA polymerase
c. a restriction enzyme
d. DNA ligase
e. an aminoacyl-tRNA synthetase
f. peptidyl transferase
g. reverse transcriptase

Answer 18

(c) a restriction enzyme to cut the vector and the genomic DNA so that the resultant pieces have compatible sticky ends; and (d) DNA ligase to stitch together the vector and insert.

Question 19

Is it possible that two different restriction enzymes could cut the human genome into exactly the same number of fragments and with exactly the same distribution of fragment sizes, yet the ends produced by the two enzymes could not be joined together by DNA ligase? explain

Answer 19

Yes, this is possible if the enzymes recognize the same sequence but cut that sequence in a different way. Such enzyme pairs are called neoschizomers. For example, both ApaI and Bsp120I recognize the sequence 5′ GGGCCC 3′, but one leaves a 5′ overhang (Bsp120I: 5′ G^GGCCC 3′) and the other leaves a 3′ overhang (ApaI: 5′ GGGCC^C 3′). These sticky ends are not compatible because they cannot base pair with each other.

Question 20

a plasmid vector pBS281 is cleaved by the enzyme BamHI (5’G^GATCC 3’) which recognizes only one site in the DNA molecule. Human DNA is digested with the enzyme MboI (5’ GATC 3’) which recognizes many sites in human DNA. These two digested DNAs are now ligated together. Consider only those molecules in which the pBS281 DNA has been joined with a fragment of human DNA. Answer the following questions concerning the junction between the two different kinds of DNA

a. what proportion of the junctions between pBS281 and all possible human DNA fragments can be cleaved with MboI?
b. what proportion of the junctions between pBS281 and all possible human DNA fragments can be cleaved with BamHI?
c. what proportion of the junctions between pBS281 and all possible human DNA fragments can be cleaved with XorII (5’ C^GATGG 3’)?
d. what proportion of the junctions between pBS281 and all possible human DNA fragments can be cleaved with BstYI (5’R^GATCT 3’)
e. what proportion of all possible junctions that can be cleaved with BamHI will result from cases in which the cleavage site in human DNA was not a BamHI site in the human chromosome?

Answer 20

a. 100%
b. 25% of the time
c. none
d. 50% of the junctions
e. 3/4

Question 21

which of the enzymes from the following list would you need to sequence DNA? What is the function of those enzymes in the process?

a. DNA polymerase
b. RNA polymerase
c. a restriction enyzme
d. DNA ligase
e. an aminoacyl-tRNA synthetase
f. peptidyl transferase
g. reverse transcriptase

Answer 21

a. DNA polymerase

Question 22

a. to make a genomic library useful for sequencing an entire genome, why would you ordinarily fragment the genomic DNA be mechanical shearing forces like sonication rather than by cutting the DNA with a restriction enzyme?
b. suppose that you wanted to make a genomic library to determine the complete sequence of a newly discovered organism’s genome, but you did not have a solicitor readily available. Explain how you could nonetheless use two or more restriction enzymes o make libraries whose clones could be sequenced so that a computer could assemble the genomic sequence
c. suppose you only had a single restriction enzyme available, and you want to make a single genomic library from which you could assemble the genomic sequence. how might you be able to achieve this goal? to make this library, would it be preferable to use a restriction enzyme that recognizes a 4-base, 6-base or 8 base sequence of DNA?

Answer 22

a. Mechanical shearing will fragment DNA at random locations, ensuring that overlap will be obtained
b. overlap is obtained by making different libraries of the same genome, each library constructed with a different restriction enzyme
c. You could perform a partial digestion with the single restriction enzyme. It will be preferable to use an enzyme that recognizes a 4 bp sequence