Chapter 6 Practice Problems Flashcards
If 30% of the bases in human DNA are A
a) what percentage are C?
b) what percentage are T?
c) what percentage are G?
a. 20%
b. 30%
c. 20%
Which of the following statements are true about double-stranded DNA?
a. A + C = T +G
b. A + G = C +T
c. A + T = G + C
d. A/G = C/T
e. A/G = T/C
f. (C+A)/(G+T) = 1
a. true
b. true
c. false
d. false
e. true
f. true
Imagine you have three test tubes containing identical solutions of purified, double stranded human DNA. You expose the DNA in tube 1 to an agent that breaks the sugar-phosphate (phosphodiester) bonds. You expose the DNA in tube 2 to an agent that breaks the bonds that attach the bases to sugar. You expose the DNA in tube 3 to an agent that breaks the hydrogen bonds. After treatment, how would the structures of the molecules in the three tubes differ?
In Tube #1 all the sugar-phosphate (phosphodiester) bonds are broken. You would in theory see individual pairs of complementary nucleotides held together by hydrogen bonds. The sugars in the nucleotides would not be attached to phosphate groups; instead, the phosphates would be free in solution.
In Tube #2 the bonds that attach the bases to the sugars are broken. You would see base pairs and sugar-phosphate chains without the bases.
Tube #3 would contain single strands of DNA since the hydrogen bonds between bases were broken.
What information about the structure of DNA was obtained from X-Ray crystallographic data?
X-ray diffraction studies yielded a crosswise pattern of spots, indicating that DNA is a helix containing repeating units spaced every 3.4 Å. The diameter of the molecule is 20 Å, indicating that DNA must be composed of more than one polynucleotide chain.
A portion of one DNA strand of the human gene responsible for cystic fibrosis is 5’….ATAGCAGAGCACCATTCTG….3’ write the sequence of the corresponding region of the other DNA strand of this gene, noting polarity. What do the dots before and after the given sequence represent?
5′…CAGAATGGTGCTCTGCTAT…3′.
The dots show that this is a short region of a much longer nucleotide chain
When a double stranded DNA molecule is exposed to high temperature, the two strands separate, and the molecule loses its helical form. we say the DNA has been denatured.
a. regions of the DNA that may contain many A-T base pairs are the first to become denatured as the temperature of a DNA solution is raised. Thinking about the chemical structure of the DNA molecule, why do you think the A-T-rich regions denature first?
b. if the temperature is lowered, the original DNA strands can reanneal, or renature. In addition to the full double-stranded molecules, some molecules of the type shown are seen when the molecules are examined under the microscope. How can you explain these structures?
a. The A-T base pairs have only two hydrogen bonds, so it takes less heat energy to denature these base pairs
b. The denatured single-stranded DNA must contain stretches of nucleotides that are complementary to a nearby sequence but in an inverted orientation. These stem-loop structures are regions where the single strand of DNA formed a double-stranded region. The loops as well as the strings holding the stems together are made from the same single molecule that is a single strand of DNA.
A particular virus with DNA as its genetic material has the following proportions of nucleotides: 20% A, 35% T, 25% G, and 20% C. How can you explain this result?
the chromosome of this virus must be single stranded.
The underlying structure of DNA is very simple, consisting of only four possible building blocks
a. how is it possible for DNA to carry complex genetic information if its structure is so simple?
b. what are these building blocks? can each block be subdivided into smaller units, and if so, what are they? what kinds of chemical bonds link the building blocks?
c. how does the underlying structure of RNA differ from that of DNA?
a. Although there are only 4 different building blocks, they can be combined in a huge number of combinations
b. Each of the four building blocks is a nucleotide. Deoxyribose plus a base makes a nucleoside. When phosphate groups are added, these become nucleotides. In a strand of DNA, the adjacent nucleotides are connected by phosphodiester bonds that link a phosphate group to both the 3′ carbon atom of the deoxyribose of one nucleotide and the 5′ carbon atom of the deoxyribose of the next nucleotide in the chain.
c. Four major differences between DNA and RNA exist: (i) In RNA the sugar is ribose instead of deoxyribose. (ii) RNA contains the base U instead of T. (iii) Most DNA molecules found in nature are double stranded while most RNA molecules are single stranded, but there are exceptions to both cases. (iv) DNA strands can be very long – more than 100,000,000 nucleotides in a human chromosome, for example. The longest naturally occurring RNA molecules are much shorter —about 20,000 nucleotides at most.
An RNA virus that infects plant cells is copies into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here?
5’ CCCUUGGAACUACAAAGCCGAGAUUAA 3’
3’ GGGAACCTTGATGTTTCGGCTCTAATT 5’
The CAP proteins binds a specific sequence of base pairs in DNA (N = any base)
a. In a long double stranded DNA molecule with random base sequence and an equal number of A-T and G-C base pairs, how many different kinds of DNA sequences could be bound by CAP?
b. In the same DNA molecule, how frequently would a CAP binding site of any type be present? Of a particular type?
c. CAP protein binds DNA as dimmer; two identical CAP protein subunits bound to each other bind DNA. Can you detect a special feature of the DNA site that CAP binds that suggests that two identical protein subunits bind the DNA?
d. CAP protein binds to the major groove of DNA. Do you expect that DNA helicase is required for CAP to bind DNA?
a. 4^6 = 4096
b. 1/(4^10) = 1/1,048,576 base pairs; 1/(4^16) = 1/4,294,967,296 base pairs
c. The DNA sequence is rotationally symmetric - or palindromic (the base sequence is identical when read in the 5’-3’ direction on each strand)
d. No; DNA helicase is not required for CAP to bind the major groove of DNA.
