Chapter 16 Practice Problems Flashcards
The promoter of an operon is the site to which RNA polymerase binds to begin transcription. Certain base changes in the promoter result in a mutants site to which RNA polymerase cannot bind. Would you expect mutations in the promoter that prevent binding of RNA polymerase to act in trans on another copy of the operon on a plasmid in the cell, or only in cis on the copy immediately adjacent to the mutated site?
Mutations in the promoter region can act only in cis to the structural genes immediately adjacent to this regulatory sequence. A promoter mutation in one operon will not affect the expression of a second, normal operon, in trans.
You have isolated a protein that binds to DNA in the region upstream of the promoter sequence of the sys gene. If this protein is a positive regulator which of the following would be true?
a. loss of function mutations in the gene encoding the DNA binding protein would cause constitutive expression of sys
b. loss of function mutations in the gene encoding the DNA binding protein would result in little or no expression of sys
b
You have isolated two different mutants (reg 1 and reg 2) causing constitutive expression of the emu operon (emu1 or emu2). one mutant contains a defect in a DNA binding site, and the other has a loss of function defect in the gene encoding a protein that binds to the site.
a. is the DNA binding protein a positive or negative regulator of gene expression??
b. -
c. what results do you predict for the two strains (I and II) if reg 1 encodes the regulatory protein and reg2 is the regulatory site?
a. Therefore, the wild-type regulatory protein blocks transcription; in other words, it is a negative regulator of emu operon expression.
c. Strain (i) will have inducible emu1 and emu2 expression while strain (ii) will have inducible emu1 and constitutive emu2 expression.
mutants were isolated in which the constitutive phenotype of a missense lacI mutation was suppressed. That is, the operon was now inducible. These suppressor mutations mapped to the operon, not to the LacI gene. what could these mutations be?
These revertants of the constitutive expression of the lac operon could be changes in the base sequence of the operator site that compensate for the missense mutation in lacI.
for each of the E. coli strains containing the lac operon alleles listed, indicate whether the strain is inducible, constitutive or unable to express beta galactosidase and permease
a. I+ o+ Z- Y+/I+ o^c Z+ Y+
b. I+ o+ Z+ Y+/ I- o^c Z+ Y-
c. I+ o+ Z- Y+/ I- o^c Z+ Y-
d. I- P- o+ Z+ Y- / I+ P+ o^c Z- Y+
e. I^s o+ Z+ Y+ / I- o+ Z+ Y-
a. , wild-type, lacI− or oC bacteria would form colonies; lacZ− or lacY− bacteria would not form colonies;
b. Wild-type, lacI− or oC bacteria will make blue colonies;lacZ− or lacY− bacteria will make white colonies;
c. the only change from part (b) is that wild-type bacteria will make white colonies.
d. Wild-type, lacI− or oC bacteria will make light blue colonies
e. the only change from part (d) is that wild-type bacteria will make white colonies.
why is the trp attenuation mechanism unique to prokaryotes?
Transcription and translation occur simultaneously in prokaryotes, but this is not so in eukaryotes
the following is a sequence of the leader region of the his operon mRNA in Salmonella typhimurium. What bases in this sequence could cause a ribosome to pause when histidine is limiting in the medium?
5’ AUGACACGCGUUAAUUU
AAACACCACCAUCAUCACCAUCA
UCCUGACUAGUCUUUCAGGC 3’
N Met Thr Arg Val Gln Phe Lys His His His His His His His Pro Asp C
Notice the 7 histidines in a row out of a total of 16 amino acids.
For each element in the list that follows, indicate what kind of molecule it is (DNA, RNA, protein, small molecule) whether it acts as a positive or negative regulator what stage of gene expression it affects, and whether it acts in cis or trans.
a. lac repressor
b. lac operator
c. CRP
d. CRP binding site
e. Trp repressor
f charged tRNA Trp
g. the anti terminator. at the trp operon
h, a terminator in the expression platform of a riboswitch
i. an sRNA that blocks mRNA translation
a. Lac repressor: protein; negative regulator; transcription initiation; in trans
b. lac operator: DNA; negative regulator; transcription initiation; in cis
c. CRP: protein; positive regulator; transcription initiation; in trans
d. CRP-binding site: DNA; positive regulator; transcription initiation; in cis
e. Trp repressor: protein; negative regulator; transcription initiation; in trans
f. charged tRNATrp: RNA + small molecule; negative regulator; transcription elongation; in trans
g. trp operon antiterminator: RNA; positive regulator; transcription elongation; in cis
h. riboswitch terminator: RNA; negative regulator; transcription elongation; in cis
i. sRNA that blocks translation: RNA; negative regulator; translation initiation; in trans
