Chapter 11 Practice Problems

Question 1

DNA element composed of short tandemly repeated sequences

Answer 1

DNA polymorphism

Question 2

arrangement of alleles of two linked gene in a diploid

Answer 2

phase

Question 3

allows identification of a gamete as a recombinant or nonrecombinant

Answer 3

informative cross

Question 4

a short oligonucleotide that will hybridize to only one allele at a chosen SNP locus

Answer 4

ASO

Question 5

two different nucleotides appear at the same position in genomic DNA from different individuals

Answer 5

SNP

Question 6

detection of genotype at a number of unlinked highly polymorphic loci

Answer 6

DNA fingerprinting

Question 7

DNA element composed of short tandemly repeated sequences

Answer 7

SSR

Question 8

location on a chromosome

Answer 8

locus

Question 9

individual with two different mutations in the same gene

Answer 9

compound heterozygote

Question 10

all exons in a genome

Answer 10

exome

Question 11

would you characterize the pattern of inheritance of anonymous DNA polymorphisms as recessive, dominant, incompletely dominant, or codominant?

Answer 11

codominant

Question 12

would you be more likely to find single nucleotide polymorphisms (SNPs) in the protein or noncoding DNA of human genome?

Answer 12

noncoding DNA

Question 13

a recent estimate of the rate of base substitutions at SNP loci is about 1 x 10^-8 per nucleotide pair per gamete

a. Based on this estimate, about how many de novo mutations (that is, mutations not found n the genomes of your parents) are present in your own genome?
b. where and when did these de novo mutations in your genome most likely occur?

Answer 13

a. your own genome should contain ~60 new base substitution mutations that were not found in the genomes of either of your parents
b. these de novo (new) mutations must have occurred in the germ lines of your parents.

Question 14

Mutations at simple sequence repeat (SSR) loci occur at a frequency of 1 x 10^-3 per locus per gamete, which is much higher than the rate of base substitutions at SNP loci (who frequency is about 1 x 10^-8 per nucleotide pair per gamete

a. what is the nature of SSR polymorphisms
b. by what mechanism are these SSR polymorphisms likely generated?
c. copy number variants also mutate at a relatively high frequency. do these mutations occur by the same or a different mechanism that that generating SSRs?
d. the SSR mutation rate is much higher than the mutation rate for new SNPs. Why then have geneticists recorded more than 50 million SNP loci but only about 100,000 SSR loci in human genomes?

Answer 14

a. SSRs are polymorphisms in which the alleles differ in the number of tandem repeats of a simple sequence iess than about 10 bp long
b. SSRs are likely generated by a mechanism of DNA polymerase stuttering (slipped misfiring of DNA strands) at repeated sequences during DNA replication
c. CNVs are repeats of units longer than 10 bp; unequal crossing over between repeats is responsible for most changes in the number of CNV repeats
d. SNPs could potentially occur at any of the 3 billion bp in the human genome SSRs could occur only at positions that already contain several repeats of a small DNA sequence.

Question 15

Using PCR, you want to amplify an approximate 1 kb exon of the human autosomal gene encoding the enzyme phenylalanine hydroxyls from the genomic DNA of a patient suffering from the autosomal recessive condition phenylketonuria (PKU)
a. why might you wish to perform this PCR amplification in the first place, given that the sequence of the human genome has already been determined?

Answer 15

You wish to know whether or not the PKU syndrome in this patient is caused by a mutation in the phenylalanine hydroxylase gene.

Question 16

which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein coding exon of the CFTR gene?
5’ GGCTAAGATCTCAATTTTCCGAG….TTGGGCAATAATGTAGCGCCTT 3’
3’ CCGATTCTAGACTTAAAAGGCTC…AACCCGTTATTACATCGCGGAA 3’
A.5’ GGAAAATTCAGATCTTAG 3’
5’ TGGGCAATAATGTAGCGC 3’
B. 5’ GCTAAGATCTGAATTTC 3’
3’ ACCCGTTATTACATCGCG 5’
C. 3’ GATTCTAGACTTAAAGGC 5’
3’ ACCCGTTATTACATCGCG 5’

Answer 16

DET B

Question 17

You sequence a PCR product amplified from a person’s genome and you see a double peak. Most of the time, this result indicates that the person is a heterozygote for a SNP at that position. But it is also possible that the result is due to a mistake in DNA replication during the PCR amplification, with DNA polymerase misincorporating the wrong nucleotide.

a. if you saw an artifactual double peak in the sequence trace, did the mistake happen. in the first few rounds of PCR amplification or in the last few rounds?
b. whether or not you see a double peak, is it more likely that a mistake would happen in the first few rounds of PCR amplification or in the last few rounds?

Answer 17

a. This scenario could occur only if the mistake happened early in the PCR amplification and was then copied over many PCR cycles.
b. It is more likely that a mistake would happen in a late round of PCR, because there are more molecules present and thus more chances for mistakes.