Chapter 10 Practice Problems

Question 1

genomic DNA sequences containing exons

Answer 1

exome

Question 2

recently evolved from intergenic DNA sequences

Answer 2

de nova gene

Question 3

gene-poor region of the genome

Answer 3

gene desert

Question 4

a nonfunctional member of a gene family

Answer 4

pseudogene

Question 5

chromosomal region with the same genes in the same order in two different species

Answer 5

syntenic block

Question 6

genes with sequence similarities in two different species that arose from a common ancestral gene

Answer 6

orthologs

Question 7

progressive elimination of individuals whose fitness is low and survival of individuals of high fitness

Answer 7

natural selection

Question 8

most frequent residues either nucleotide or amino acid, found at each position in a sequence alignment

Answer 8

consensus sequence

Question 9

set of genes related by processes of duplication and divergence

Answer 9

gene family

Question 10

genes that arose by duplication within a species

Answer 10

paralog

Question 11

joining together of exon in a gene in different combination

Answer 11

alternative RNA splicing

Question 12

a discrete part of a protein that provides a unit of function

Answer 12

protein domain

Question 13

which of the enzymes from the following list would you need to make a cDNA library? what is the function of those enzymes in the process?

a. DNA polymerase
b. RNA polymerase
c. a restriction enzyme
d. DNA ligase
e. an aminoacyl-tRNA synthetase
f. peptidyl transferase
g. reverse transcriptase

Answer 13

reverse transcriptase (g) to copy mRNA into the first strand of cDNA. You would probably also need DNA polymerase (a) to copy the first strand of cDNA in order to make double-stranded cDNA.a restriction enzyme (c). DNA ligase (d) to seal up the recombinant DNA molecule.

Question 14

One of the following sequences was obtained from a cloned piece of a genome that includes parts of two exon of a gene. The other sequence was obtained from the corresponding part of a cDNA clone representing the mrRNA for this gene.
sequence 1: 5’ TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3’
sequence 2: 5’ TAACTGATTTCTTTCACCTA 3’
a. which sequence is the genomic fragment and which is the cDNA fragment?
b. write the RNA-like strand of the genomic sequence and indicate the 5’ and 3’ ends. Draw vertical lines between the bases that are the exon/intron boundaries
c. what sequence features needed for splicing are missing from the problem
d. assuming both exon are made only of protein coding nucleotide sequences, what can you determine about the amino acid sequence of the protein product of the gene?

Answer 14

a. Sequence 1 is the genomic fragment; Sequence 2 is the cDNA sequence
b. 5′ TAGGTGAAAGA|GTAGCCTAG|AATCAGTTA 3′
c. a lariat branchpoint sequence is absent. In addition, the intron lacks some of the pyrimidine-rich nucleotides usually found just upstream of the splice acceptor site
d. The translation of this mRNA would be:
N …Gly Glu Arg Asn Gln Leu… C.

Question 15

a. what sequence information about a gene is lacking in a cDNA library?
b. can clones in a cDNA library contain 5’ UTR sequences? 3’ UTR sequences?
c. would you be likely to find on average longer ORFs in cloned sequences from a genomic library or from a cDNA library? explain

Answer 15

a. Because cDNAs are made from mRNAs, they lack introns and they also do not have regulatory region information such as promoters and enhancers.
b. Clones in a cDNA most definitely can include 5′ UTR and 3′ UTR sequences.
c. You would be more likely to find longer ORFs on average in cDNA clones that in genomic clones.

Question 16

why do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas geneticists studying bacteria almost never do? why might bacterial geneticists have difficulties constructing cDNA libraries even if they wanted to?

Answer 16

The main reason geneticists studying eukaryotic cells make cDNA libraries is to determine how a gene’s primary transcript is spliced in a given cell type. Almost all eukaryotic genes are interrupted by introns. In fact, only a small proportion (~1-2% in humans) of most eukaryotic genomes are made of protein-coding exons. In contrast, the genomes of bacteria do not have introns (with very few rare exceptions) and the large majority of the base pairs in bacterial genomes are protein-coding regions. The main difficulty for bacterial geneticists in constructing cDNA libraries is that bacterial mRNAs do not have poly-A tails.

Question 17

consider three different kinds of human libraries: a genomic library, a brain library, and a liver cDNA library
a. suppose that all three of these libraries are sufficiently large so as to represent all of the different human nucleotide sequences that the library could possibly include. which of these libraries would then correspond to the largest of the total human genome?
b. would you expect any of these libraries not to overlap the others at all in terms of the sequences it contains? explain
c, how do these three libraries differ in terms of the starting material for constructing the clones in the library?
d. why would you need to sequence many clones from many cDNA libraries to annotate a genome?

Answer 17

a. The genomic library would contain the entire human genome, while the brain and liver cDNA libraries would contain exons of only some genes.
b. All three of these libraries should include some of the same sequences
c. The genomic library starts from human genomic DNA; the liver cDNA library begins with the total mRNA pool extracted from liver; the starting material for the brain cDNA library is the total mRNA pool extracted from brains.
d. To annotate a genome, you would have to sequence many clones from many cDNA libraries because different genes are transcribed in different tissues and because some genes are transcribed only rarely in any tissue.

Question 18

This problem investigates issues encountered in sequencing the inserts in cDNA libraries
a. if you sequences many clones individually, wouldn’t you spend many of your resources inefficiently sequencing cDNAs for the same type of mRNA molecule over and over again? explain. does this apparently inefficient process provide any useful information beyond the sequences of individual mRNAs?
b. suppose that you identified a clone with a cDNA insert that was 4 kb long. You could determine the entire sequence of the clone by shearing the DNA into small random fragments, cloning these fragments into a vector to make a mini shotgun library, and then sequencing hundreds of these clones to allow the computer to assemble the full sequence of the 4 kb long insert. However, this procedure would be insufficient.
an alternative that requires many fewer sequencing reactions is called primer walking. the technique involves the synthesis of additional oligonucleotide primers corresponding to cDNA sequences you have just obtained. Diagram how you would sequence the entire 4kb-long cloned cDNA using prier walking, indicating the vector and insert, all orimers that ou would use, and all the sequences you would obtain. Assume that each sequence read is 1 kb

Answer 18

a. Yes, if you sequenced many clones from a cDNA library, you would sequence many independent copies of the same mRNA molecules.
b. A diagram of the primer walking procedure followsYou would use the sequence information you obtain in each step of the procedure to design the primers needed for the next step. These primers would be located near the 3′ end of the sequences obtained, and the 5′-to-3′ orientation of the primers would “point” in the direction of the insert DNA sequences you would like to obtain in the next step. In the following figure, the black arrows represent the primers you would use

Question 19

Using a cDNA library, you isolated two different cDNA clones that have sequences indicating that they both correspond to mRNAs transcribed from the same nerve growth factor gene. The beginning and ending sequences of the clones are the same, but the middle sequence is different. How can you explain the different cDNAs?

Answer 19

The two different cDNA clones represent alternatively spliced products of the primary transcript of the same gene