Chapter 15, 16, & Selected Topic Flashcards
Gene expression
conversion of genotype to phenotype
Why is it important to control gene expression?
- Gene expression is energetically expensive
- Eukaryotes: maintain homeostasis
- Prokaryotes - respond to environmental changes
Regulatory proteins
proteins that modulate ability of RNA polymerase to bind to promoter
Positive control
Increases frequency of initiation
Negative control
Decreases frequency of initiation
Negative control is mediated by _________
repressors
Effectors
Alter conformation of repressor to enhance or abolish its binding to DNA
Positive control is mediated by _________
activators
Lac induction
presence of lactose prevents a repressor protein from binding to its regulatory sequence
Trp repression
the presence of tryptophan causes a repressor protein to bind to its regulatory sequence
List the three genes that make up the lac operon and what they encode.
LacZ - B-galactosidase
LactY - lactose permease
LacA - lactose transacetlyase
Lac repressor
Controls initiation of transcription of lac operon
Describe the induction of the lac operon.
- In absence of lactose: lac repressor binds to DNA at operator site -> prevents transcription of operon
- Lac operon is transcribed (induced) when CAP is bound and when repressor is not bound
Allolactose
- effector that controls DNA binding of repressor
- produced when lactose is available
- binds to repressor, altering its conformation so that it no longer can bind to operator
Glucose repression
Preferential use of glucose in presence of other sugars (e.g., lactose)
Catabolite activator protein (CAP)
activator protein with cAMP as an affector
CAP binds to _______
cAMP
The level of cAMP is reduced in the presence of ________
glucose
The level of ______ is reduced in the presence of glucose
cAMP
The action of CAP is sensitive to ________ levels.
glucose
Allolactose allows _________ of the operon.
induction
What environmental conditions allow transcription of lac operon to occur?
CAP binds + lactose is present
What environmental conditions allow transcription of lac operon not to occur?
- Glucose is present + repressor binds
- CAP + repressor binds
General transcription factors
necessary for assembly of transcription apparatus and recruitment of RNA polymerase II to a promoter
Specific transcription factors
increase level of transcription
Promoters
the binding sites for general transcription factors
_______ are the binding sites for general transcription factors.
Promoters
Enhancers
Binding sites for specific transcription factors
_________ are the binding sites for specific transcription factors.
Enhancers
Coactivators
bind to transcription factor
Transcription complex
What makes control of transcription in Eukaryotes more complicated than in Prokaryotes?
- DNA is organized into chromatin - complicates DNA-protein interactions
- Transcription and translation are separated physically and temporally
Proto-oncogenes
Normal cellular genes that become oncogenic when mutated
Tumor-suppressor genes
genes that inhibits cell division
Oncogenes arise from __________
proto-oncogenes
What is the most frequently mutated gene in human tumors?
tumor-suppressor gene (TP53)
TP53
encodes p53 protein
p53 is involved in which cell-division checkpoint?
G1/S checkpoint
Explain p53/s contribution to the G1/S checkpoint.
In G1/S checkpoint, damaged DNA signals p53 to halt the cell cycle
What are examples of genes in humans that are mutated in germ-line cells?
BRCA1/BRCA2
What is the result of mutations in BRCA1/BRCA2 genes in humans?
increase a woman’s risk of developing hereditary breast or ovarian cancers
increase a man’s risk of developing hereditary prostate or breast cancers
What percentage of breast cancers involve the duplication of the HER2 gene?
10-20%
How many copies of the HER2 gene are typically present in a diploid cell?
2
What is the function of the HER2 gene?
- encodes for a receptor protein
- activates a signal transduction pathway -> resulting in cell proliferation
What is the result of the overexpression of HER2 receptors in cells?
Cells grow/divide in an uncontrolled way
What are the control mechanisms of lac operon?
Repressor protein, binding CAP site
What are the environmental signals of lac operon?
allolactose, cAMP
What are the sensors of lac operon?
Site on repressor protein, CAP
High glucose ______ cAMP + lactose
inhibits
Low/no glucose ________ cAMP + lactose
stimulates
CHAPTER 15
Central dogma of biology
Information passes from gene (DNA) to an RNA copy of gene
RNA copy directs sequential assembly of a chain of amino acids into a protein
In the central dogma of biology, ____ is transcribed to make ____, which is translated to make a ______.
DNA; mRNA; protein
Transcription
DNA-to-RNA step
Translation
RNA-to-protein step
The process of ____ produces an RNA copy of information in DNA.
Transcirption
What is the difference between a coding and a template strand in Transcription?
Template (antisense) strand - DNA strand that is copied
Coding (sense) strand - DNA strand that is not used
In what way is the mRNA transcript not identical to the coding strand?
The mRNA transcript replaces thymine (T) with uracil (U)
mRNA
Intermediate form of information in DNA transported out of nucleus to cytoplasm for ribosomal processing
tRNA
Intermediary adapter molecule between mRNA and aminoa cids
What are the functions of tRNA?
- Interpret informaiton in mRNA
- Help position amino acids on ribosome
rRNA
class of RNA found in ribosomes
Codon
Sequence of three nucleotides
Reading frame
Correst succession of nuleotides in triplet codons that specific amino acids on translation
What are the three stop codons?
UAA, UGA, UAG
What is the start codon and what amino acid does it encode?
AUG; methionine
Degenerate
some amino acids are specificed by more than one codon
How many possible codons are there?
64
Transcribe the following mRNA transcript into its amino acid sequence:
5’ - AUGUUUUCCACAGCCUAAUUG
All organisms (for the most part) share a signle genetic code, what does this imply?
Describe the RNA polymerase used in Prokaryotic transcription. What does the sigma subunit do?
RNA polymerase in prokaryotes exists in two forms :
1. Core polyermase - two identical a subunits, b subunit, b’ subunit
2. Holoenzyme - formed by addition of a sigma subunit to core polyermase
- Sigma subunit recognizes promoter elements at -35 and -10 and binds to DNA
The active site of the core polymerase is formed by ____ and ____ subunits.
beta; beta’
What is a promoter, and does it become part of the transcript?
Forms recognition and binding site for RNA polymerase. No it is not, because the promoter is not transcribed
Start site
Where transcription actually begins
Terminator
signals end of transcription
Transcription unit
region from promoter to terminator
Describe the upstream and downstream orientation of transcription.
+1 - bases downstream of start site
-1 - bases upstream of start site (e.g., -35 = 35 nt UPSTREAM of start site)
Where is the promoter in prokaryotes located?
35 nt upstream of start site (-35)
What is the first step of prokaryotic transcription?
RNA polymerase binds to promoter
Transcription bubble
region containing RNA polymerase, DNA template, and growing RNA transcript
While in the replication bubble, the growing RNA transcript is a ________________________.
RNA:DNA hybrid
Hairpin
Double-stranded stem with a single-stranded loop formed by a self-complementary G-C region that causes RNA polymerase to pause
What is the simplest terminator of transcirption in prokaryotes?
Series of G-C base-pairs followed by a series of A-T base-pairs
In prokaryotes, transcription and translation are ______.
coupled
Operon
cluster of adjacent structural genes transcribed as a unit into a single mRNA molecule (i.e., genes encoding related functions are clustered together)
In transcription, new RNA bases are added to what part of the previous nucleotide? (What carbon?)
List the three RNA polymerases in eukaryotes and what they transcribe?
- RNA polymerase I - transcribes rRNA
- RNA polymerase II - transcribes mRNA
- RNA polymase III - transcribes tRNA
What is the promoter of RNA polymerase II?
TATA box
5’ cap
- structed added to 5’ end of mRNA
- ## methylated GTP is added to 5’ PO4- group
3’ poly-A tail
series of adenine residues added to 3’ end of mRNA
T or F: each polymerase recognizes its own promoter.
T
What is the role of the 5’ cap?
translation, RNA stability, and further processing
The 3’ poly-A tail in eukaryotes is similar to which structure in prokaryotes?
Hairpin loop
Introns
Exons
pre-mRNA splicing
Spliceosome
Alternative splicing
A single transcript cna be spliced into different mRNAs by using different sets of exons
Aminoacyl-tRNA synthetases
enzyme that attaches amino acids to correct tRNA during tRNA charging reaction
Describe the two functional ends of tRNA.
- Acceptor stem - 3’ end of mRNA; porton where amino aids attach to
- Anticodon loop - contains anticodon seuqence that can form base-pairs with codons in mRNA
Charging reaction
reaction by which aminoacyl-tRNA synthesase attaches a specific amino acid to the correct tRNA
T or F: charging reaction is exergonic.
F: endergonic
Does the charging reaction require ATP?
Yes
Charged tRNA
tRNA joined to an amino acid
Where does translation occur?
Ribosomes
T or F: There is one aminoacyl-tRNA synthetase for ALL 20 amino acids
F: There is one aminoacyl-tRNA synthetase for EACH 20 amino acids
Describe the three binding sites in bacterial ribosomes.
- A (aminoacyl) site - binds to tRNA carrying next amino acid to be added
- P (peptidyl) site - binds to tRNA attached to growing polypeptide chain
- E (exit) site - binds to tRNA carring preivous amino acid added
tRNAs move through the three binding sites during the process of _______.
Elongation
Wat does peptidyl transferase do and where is it located?
enzyme that catalyzes formation of peptide bonds; resides in large subunit
What is the structure of the initation complex in prokaryotes?
- initiator tRNA charged with N-formylmethione (chemically modified methionine)
- small ribosomal subunit
- mRNA strand
Ribosom-binding sequence (RBS)
Conserved sequence in 5’ end of mRNA complementary to 3’ end of small subunit rRNA
T or F: RBSs are in both prokaryotes and eukaryotes.
F: only in prokaryotes
What is difference between eularyotic and prokaryotic initation
Prokaryotes: initating amino acid - N-formylmehionine
Eukaryotes: initating amino acids - methionine
Elongation factor (EF-Tu)
binds to charged tRNA and GTP
Describe the details of the elongation cycle in translation.
- tRNA comes to ribosome bound to EF-Tu and GTP. After arrival, GTP is hydrolzyed, and EF-Tu and GDP dissociate from ribosome
- Peptidly transferase catalyzes the formation of peptide bonds between amino acid in A site and growing chain in P site
- Ribosome translocation - tRNA moves from A site to P site
Wobble pairing
a single tRNA can read more than one codon in mRNA
Release factors
proteins that release newly made polypeptide chain from ribosome
What two places can translation occur in eukaryotes?
Cytoplasm or RER
Siganl recogntion particle (SRP)
cytoplasmic complex of proteins that recognizes and binds a signal sequence of polypeptide
Changing a single base in a nucleotide sequence can result in devastating changes to the __________.
Phenotype
What are the three types of point mutations?
- Missense mutations
- Nonsense mutations
- frameshit mutations
Point mutation
mutation that alters a single base
Missense (nonsynonymous) mutation
Nonsense mutation
mutation that changes a codon that encodes an amino acid to a stop codon
What is the outcome of a nonsense mutation?
Stop codon will cause translation to terminate prematurely
Frameshift mutation
mutation in which a base is added to or deleted from the DNA sequence; alters reading frame
Explain how the impact of frameshift mutations depend on where it occurs in the gene.
A framshift mutation early in the gene causes a greater change in sequence; all amino acids after mutation are affected
Deletion
mutation in which a portion of a chromosome is lost
Duplication
mutation in which a portion of a chromosome is duplicated
Cri-du-chat syndrome
deletion on chromosome 5
Inversion
Translocation
Indel
gain or loss of 1-50 bp
Translocation
one chromosome is broken and becomes part of another
Recpirocal translocation
Both chromosomes are broken and exchange material (i.e., material in a chromosome is transferred between chromsomes)
In what way can mutations be beneficial to an organism/species?
Mutations provide a source of variation for evolution to act on
