WRAP questions Flashcards
AIM:
We performed a study to assess whether neonatal hypertension is associated with maternal SSRI use during late pregnancy.
METHODS:
Between 1998 and 2003, we enrolled 377 women whose infants had hypertension and 836 matched control women and their infants. Maternal interviews were conducted by nurses, who were blinded, to establish medication use in pregnancy and potential confounders.
What kind of study design is being used?
Case-control
A study is performed to establish whether there is a correlation between BMI and the onset of type 2 diabetes. 1000 non-diabetic participants are recruited between the ages of 30 and 40 and their BMIs noted. They are monitored for 10 years and their diabetic status is recorded.What kind of study design is being used?
Cohort-prospective
Which factor makes it hard for observational studies to establish cause and effect?
cofounding variables
Which of the following is the key difference between experimental and observational research?
experimental research manipulates variables
When conducting a randomised controlled trial, what does the term randomisation mean?
Participants are equally likely to be assigned to the intervention or control groups
A headmaster hears that cognitive behavioural therapy (CBT) can increase the performance of under-achieving students. He devises a trial where all pupils sit a progress test: - Those whose score is more than one standard deviation below the mean are given CBT the following term. - Another progress test is then sat by all the pupils. The mean score for the CBT treated students is calculated and found to be much closer to the total mean score.
What is the simplest explanation of this result?
regression to the mean
A headmaster hears that cognitive behavioural therapy (CBT) can increase the performance of under-achieving students. What design would be best?
randomised control trial
A headmaster hears that cognitive behavioural therapy (CBT) can increase the performance of under-achieving students.Who would you study?
under-achieving students
According to Thomas Kuhn, a paradigm shift changes the way we view the world.What happens to start the process of a paradigm shift?
evidence contradicts current paradigm
You are monitoring levels of the retrovirus, HIV, in the blood of AIDS patients. You perform qPCR using primers specific for HIV sequences. Which of the following steps comes first, when preparing your samples?
add reverse transcriptase
Cystic fibrosis suffers often suffer from bacterial lung infections. In order to determine if they are susceptible to infection by a particular bacterial species, you decide to analyse sputum samples from a sample of patients.Which technique would provide the most information on which bacteria were present in the samples
next generation sequencing
You are performing an intention-to-treat analysis on whether drinking milk can increase bone strength in the elderly. You design a randomised control trial with two groups - those in the intervention group are given milk to drink, whereas those in the control group are asked not to drink milk. Bone strength is measured after 1 month.A participant in the control group thinks that drinking milk must be a good idea and decides to drink it daily.How should their bone strength data be analysed?
as a control data point
During a randomised control trial, allocation concealment should be used to assign participants to control or intervention groups.Why is it used?
to prevent selection bias
You are performing a phase 1 clinical trial on a new drug for type 2 diabetes. The drug is proposed to work by increasing insulin sensitivity.What should you measure?
drug safety
You are performing a phase 1 clinical trial on a new drug for type 2 diabetes. The drug is proposed to work by increasing insulin sensitivity.What is a key feature of such a trial?
the dose is increased sequentially
The BCR-ABL gene is made as a result of a chromosomal translocation (Ph+) and is responsible for 95% of cases of chronic myeloid leukaemia.Which of Koch’s postulates does it satisfy? (4)
- it is found in diseased and not healthy people
- it can be propagated in culture
- it indues the disease when introduced into healthy people
- it can be re-isolatedfrom infected cells and used to cause disease
When deciding whether to fund a particular treatment (or Health Technology), NICE uses the QALY (Quality Adjusted Life Year) to generate a generic measure of its utility.
Time trade-off analysis Comparison of different treatments Measurement of the clinical efficacy of a drug Calculation of a QoL score Calculation of treatment costs
For your project, you are performing a randomised controlled trial to answer the question ‘Does exercise improve learning?’What is your research hypothesis?
exercise improves learning
For your project, you are performing a randomised controlled trial to answer the question ‘Does exercise improve learning?’
How could you measure learning?
-Performance in an IQ test
-Performance in end of year ASK
-Performance in an essay you set
-Memory recall test (i.e. objects on a tray)
-Performance in ASK test you set
performance in ASK test you set
For your project, you are performing a randomised controlled trial to answer the question ‘Does exercise improve learning?’How might you rewrite your research question?
does exercise improve performance in ASK exams
For your project, you are performing a randomised controlled trial to answer the question ‘Does exercise improve learning?’How will you know your study has been successful?
you will have evidence to support or reject your hypothesis
You wish to know which genes are up-regulated by testosterone. You design an experiment where cultured muscle cells are treated with testosterone or a control.Which technique would be the most suitable to gather the required data?
RNA sequencing
You wish to know which genes are up-regulated by muscle cells in response to testosterone. You design an experiment where cultured human muscle cells are treated with testosterone or a control.Before you start, what information do you need to know in order for this technique to be useful?
the sequences of all known human genes
Type 2 diabetes is a complex disease resulting from an interaction between several genetic and environmental factors. Estimates of heritability range from 20-80%.How might you identify genetic variants associated with the disease?
GWAS
GWAS studies of T2D have identified several SNPs associated with the disease. Each SNP correlates with a significant but very small increase in the likelihood of having T2D. Generally, why don’t GWAS studies find SNPs with large effects?
these can be deleterious for survival
Which term is used to describe co-segregation of a genetic marker with a disease phenotype?
linkage
The regulatory regions of many genes are subject to epigenetic modifications. There are several instances of diseases that correlate with particular epigenetic profiles. You are a researcher comparing an ‘Alzheimer’s’ tissue-bank with unaffected tissue, to see if there is a particular epigenetic profile associated with the disease.What kind of study design is this?
case-control study
You are attempting to develop a molecule to inhibit the tyrosine kinase activity of the BCR-ABL protein. In order to identify lead compounds for further development, you decide to screen a library of 1000 compounds. What assay would be the most suitable?
- Proliferation assay of a human cell line expressing BCR-ABL
- Myeloid cell proliferation in BCR-ABL transgenic mouse
- In vitro kinase assay with purified BCR-ABL protein
- Phase 1 clinical trial
- Proliferation assay of a wild-type human cell line
in vitro kinase assay with purified BCR-ABL protein
Alzheimer’s disease is characterised by several changes in the brain. One of these is the formation of amyloid plaques, which are thought to contribute to neuronal death. The 5xFAD mouse model has been engineered to make an abundance of amyloid plaques.Which studies could be usefully performed using this mouse?
- Efficacy of plaque-clearing antibodies
- Evaluation of environmental risk factors for plaque formation
- Plaque-induced neuronal function
- Epigenetic causes of plaque formation
efficacy of plaque -clearing antibodies
-plaque-induced neuronal function
You wish to create a mouse model to study the effect of a specific substitution mutation in a gene. The mutation is thought to be oncogenic and contribute to the formation of liver tumours. What model would be the most suitable?
Knock-out or knock-in mouse
knock- in
You are studying the regulation of cell division and want to know which genes are required for mitosis. You decide to use yeast as a model organism for your study.Which technique would be the most suitable?
- RNA sequencing of dividing cells
- PCR candidate genes
- Randomly mutate genes
- Genome sequencing
- Western blotting
randomly mutate genes
the screen- assumption
the genes/ process is conserved in humans
the screen- advantages
- quick
- simple genetics
- cheap
- ethics free
- bias free
You wish to study the recruitment of inflammatory cells to wounds and wish to film the path of their migration from when they exit the circulation to when they reach the wound.Which model organism would be the most suitable?
- yeast
- worm
- fruit fly
- zebrafish
- mouse
zebrafish
You wish to study the contribution of inflammatory cells to scarring during wound healing. You have wild-type mice and also a colony of PU.1 knockout mice. As a consequence of the knockout, PU.1 -/- mice are unable to produce any inflammatory cells (e.g. macrophages and neutrophils) and interestingly, they do not scar. How could you begin to investigate which proteins made by inflammatory cells maybe involved in scar formation?
- Compare gene expression in wound tissue between the two mice
- Compare gene expression in fibroblasts between the two mice
- Sequence the DNA of both mice
- Make knockouts of candidate genes
- Immunofluorescent staining
compare gene expression in wound tissue between the two mice
You wish to target a double stranded DNA sequence using CRISPR technology. You are using Cas9 from S.pyogenes which recognises the PAM sequence of NGG (where N is any base). The top strand of the sequence is:How many potential target sequences are there?
5’ GATTCCTATTACCATGAATTATGGGTATTCGGTGCAGATTACGA 3’
5
When designing your guide sequence you use an online tool to assess the candidate targets.Which of the following properties of a guide sequence would preclude its use?
- Hairpin formation
- Similar off-target sequences
- It is on the –ve strand of DNA
- It is on the X chromosome
- It is intronic
similar off target sequences
