WRAP 4/5/6/7 Qs Flashcards
You are attempting to develop a molecule to inhibit the tyrosine kinase activity of the BCR-ABL protein. In order to identify lead compounds for further development, you decide to screen a library of 1000 compounds.
What assay would be the most suitable?
Proliferation assay of a human cell line expressing BCR-ABL
Myeloid cell proliferation in BCR-ABL transgenic mouse
In vitro kinase assay with purified BCR-ABL protein
Phase 1 clinical trial
Proliferation assay of a wild-type human cell line
In vitro kinase assay with purified BCR-ABL protein
Alzheimer’s disease is characterised by several changes in the brain. One of these is the formation of amyloid plaques, which are thought to contribute to neuronal death. The 5xFAD mouse model has been engineered to make an abundance of amyloid plaques.
Which studies could be usefully performed using this mouse?
Efficacy of plaque-clearing antibodies
Evaluation of environmental risk factors for plaque formation
Plaque-induced neuronal function
Epigenetic causes of plaque formation
Efficacy of plaque-clearing antibodies
Plaque-induced neuronal function
You wish to create a mouse model to study the effect of a specific substitution mutation in a gene. The mutation is thought to be oncogenic and contribute to the formation of liver tumours.
What model would be the most suitable?
Knock-out mouse
Knock-in mouse
Knock-in mouse
You are studying the regulation of cell division and want to know which genes are required for mitosis. You decide to use yeast as a model organism for your study.
Which technique would be the most suitable? RNA sequencing of dividing cells PCR candidate genes Randomly mutate genes Genome sequencing Western blotting
randomly mutate genes
You wish to study the recruitment of inflammatory cells to wounds and wish to film the path of their migration from when they exit the circulation to when they reach the wound.
Which model organism would be the most suitable? Yeast Worm Fruit fly Zebrafish Mouse
zebra fish
You wish to study the contribution of inflammatory cells to scarring during wound healing. You have wild-type mice and also a colony of PU.1 knockout mice. As a consequence of the knockout, PU.1 -/- mice are unable to produce any inflammatory cells (e.g. macrophages and neutrophils) and interestingly, they do not scar.
How could you begin to investigate which proteins made by inflammatory cells maybe involved in scar formation?
Compare gene expression in wound tissue between the two mice
Compare gene expression in fibroblasts between the two mice
Sequence the DNA of both mice
Make knockouts of candidate genes
Immunofluorescent staining
Compare gene expression in wound tissue between the two mice
- You wish to target a double stranded DNA sequence using CRISPR technology. You are using Cas9 from S.pyogenes which recognises the PAM sequence of NGG (where N is any base). The top strand of the sequence is:
5’ GATTCCTATTACCATGAATTATGGGTATTCGGTGCAGATTACGA 3’
How many potential target sequences are there?
5
- -> think about its complementary stand too
- -> has to end in GG
5’ GATTCCTATTACCATGAATTATGGGTATTCGGTGCAGATTACGA 3’
3’ CTTAGGATAATGGTACTTAATACCCATAAGCCACGTCTAATGCT 5’
. When designing your guide sequence you use an online tool to assess the candidate targets.
Which of the following properties of a guide sequence would preclude its use?
Hairpin formation Similar off-target sequences It is on the –ve strand of DNA It is on the X chromosome It is intronic
You are recruiting participants for a randomised controlled trial to test the efficacy of a new drug in treating her-2 positive breast cancer.
Which of the following does the Declaration of Helsinki state you should do?
Gain informed consent Not put the patient at risk Allow the patient to withdraw Publish your findings Use competent staff
all of these
You are recruiting participants for a randomised controlled trial to test the efficacy of a new drug in treating her-2 positive breast cancer.
How do you minimise risk?
- test on animals first
- phase 1 on healthy people testing side effects and drug dosage
The Tuskegee trial contravened several points in the Declaration of Helsinki.
Which guidelines were flouted?
-Safety of human subjects takes precedence over all over considerations
- ethics committee
- informed consent
- vulnerable pop
- hazards are predictable
The current drug for her-2 positive breast cancer is very expensive and is not available to all patients in the UK. The new drug is cheaper.
Which of the following does the Declaration of Helsinki state you should use as a control to compare the new drug with?
the current therapy
You are performing your research project to determine whether background noise affects concentration. You do not want the participants to know that this is what you are studying as you think it may confound your results.
How do you ensure informed consent is obtained?
- It is not required – there is no harm
- You can’t – the study is unethical
- Debrief the participants
- Ask for consent to ‘Any –Purpose Research’ (APR)
- Turn a blind-eye
it is not required- no harm
The Milgram experiment
How do you ensure informed consent is obtained?
debrief
Part of Wakefield’s hypothesis was that measles virus in the gut led to colitis and ultimately, regressive autism. One of his research team performed sensitive screening for the virus in patient gut biopsies.
How might he have done this?
PCR
