Quiz 3

Question 1

The Anticodon 3’ -AUC-5’ will pair with which codon?

a.) 5’-ATC-3’
b.) 5’-AUC-3’
c.) 5’-UAG-3’
d.) 3’-UAG-5’
e.) 5’-TAG-3’

Answer 1

5’-UAG-3’

Question 2

Given the following coding strand, what is the fourth amino acid of the polypeptide produced; how many codons will comprise the mRNA read by the ribosome; how many amino acids will be part of the polypeptide? (It’s important that you know the short-cut of going from coding strand directly to protein – ask for help if you don’t understand).

5’ - TATAAACTTGCGGCCATGAAATATTTCGCGCCGCGCCAGGCATAACGGGGCCAGTGA - 3’

Answer 2

Phenylalanine; 10 codons, 9 aa’s

Question 3

What is NOT a post-translational modification (PTM) of a protein?

a.) Glycosylation
b.) Phosphorylation
c.) Dephosphorylation
d.) Degradation
e.) Methylation

Answer 3

Degradation

Question 4

Which organisms would decoupled transcription and translation occur?

Answer 4

Eukaryotes