Quiz 1

Question 1

Which of the following is false considering the synthesis of macromolecules?

a.) In biological contexts, the synthesis of macromolecule polymers requires energy, while hydrolysis of macromolecules into monomer units releases energy.
b.) R-groups are responsible for H-bonding interactions between amino acids leading to the formation of secondary structure.
c.) The nucleotide structure of DNA and RNA monomers differ only by the replacement of Thymine of DNA by Uracil in RNA, and the lack of a 2’ OH on the deoxyribose sugar of DNA
d.) Phospholipids are amphipathic, meaning they have both hydrophilic and hydrophobic components
e.) All of the above are true.

Answer 1

b.) R-groups are responsible for H-bonding interactions between amino acids leading to the formation of secondary structure.

Question 2

Why do Chargaff’s Rules (A=T and C=G) hold for DNA but not RNA?

a.) RNA is generally single stranded and DNA is double stranded
b.) RNA has ribose instead of deoxyribose, like DNA
c.) RNA is smaller than DNA

Answer 2

a.) RNA is generally single stranded and DNA is double stranded.

Question 3

Which of the following RNA polymers would H-bond (through complementary nitrogenous base pairing) with the DNA polynucleotide below?

5’ - GCATACATGTATCCCGCCAGC - 3’

Answer 3

3’ - CGUAUGUACAUAGGGCGGUCG - 5’

Question 4

As a scientist, you seek to prove that DNA is the hereditary macromolecule by replicating the Hershey-Chase experiment. You culture the lambda phage in heavy and light Cl (Cl-36 is heavy and radioactive - the most abundant is Cl-35, lighter and non-radioactive). You purify the phage from their growth media and infect the E. coli, where will you detect radioactivity?

a.) Within the E. coli pellet as the DNA has entered the bacterial cells
b.) On the E. coli cell surface (or phage fraction), as part of the phage protein coat
c.) In the supernatant (free liquid) of your test tube
d.) Both A and B
e.) None of the Above

Answer 4

None of the Above

Question 5

Which AA substitution for alanine would least likely affect the three-dimensional shape of the resulting protein?

a.) Tyrosine
b.) Cysteine
c.) Isoleucine
d.) Histidine
e.) Aspartic Acid

Answer 5

Isoleucine

Question 6

Where would the leucine side chain most likely be found in a protein dissolved in water?

a.) The interior of the protein in contact with nonpolar side chains
b.) The interior of the protein in contact with polar side chains
c.) Exterior of the protein
d.) Interior of the protein in contact with water
e.) Either on the interior of exterior of the protein.

Answer 6

a.) In the interior of the protein in contact with non polar side chains

Recall: Lipid bi layer

Question 7

Which of the following peptides could be found inside a phospholipid bilayer membrane due to its hydrophobic properties?

a.) RKE
b.) HGD
c.) GTC
d.) LMV
e.) STA

Answer 7

LMV

Question 8

Which statements below are TRUE in terms of interactions between macromolecules?

a.) DNA and carbohydrates are the only macromolecules that incorporate ester covalent bonds to link monomer units
b.) Channel proteins that allow for the movement of water, and are embedded in the plasma membrane, will likely have hydrophobic R groups that face into the phospholipid tails and hydrophobic R groups that face into the pore that allows for the movement of water (through the protein)
c.) Nucleic acids contain a carbohydrate (a different macromolecule) as part of its monomer structure
d.) A and C

Answer 8

C.) Nucleic acids contain a carbohydrate (a different macromolecule) as part of its monomer structure