Microbiology 154 Exam 2 Review Flashcards
Which kind of organism is killed by atmospheric oxygen?
a) facultative anaerobe
b) obligate aerobe
c) obligate anaerobe
d) aerotolerant anaerobe
c. obligate anaerobe
Toxic hydrogen peroxide produced in some bacteria can be broken down into water and oxygen by which enzyme?
a) superoxide dismutase
b) peroxidase
c) hydroxylase
d) catalase
d. catalase
Which of the following is not likely to be a reason for why exponential growth stops?
a) accumulation of waste products
b) exhaustion of nutrients
c) harmful changes in pH
d) bacteria becoming dormant
d. bacteria becoming dormant
In the stationary phase of growth in batch cultures
a) the number of microbial deaths exceeds the number of new cells formed
b) the number of microbial deaths is equal to the number of new cells formed
c) new cells are no longer formed because of adverse environmental conditions
d) cellular reproduction is most active
b. the number of microbial deaths is equal to the number of new cells formed
The removal or destruction of all microorganisms is called
a) sterilization
b) disinfection
c) pasteurization
d) sanitization
a. sterilization
If a population of 100,000 microbes has been treated with an antimicrobial chemical solution for two minutes and 90% of the population dies per minute, how many microbes remain after two minutes?
a) 100,000
b) 10,000
c) 1000
d) 100
c. 1000
The surface of your kitchen counter has 108 bacteria so you clean it with a disinfectant that kills 99.9% of germs on contact. How many bacteria remain and are viable?
a) 10^7
b) 10^6
c) 10^5
d) 10^4
c. 10^5
What is the process that turns on the transcription of a gene or genes?
a) induction
b) repression
c) translation
d) replication
a. induction
A segment of DNA that codes for a functional product is a(n)
e) genetic code
a) gene
b) codon
c) anticodon
a. gene
Transcription begins when RNA polymerase binds to the DNA at the
a) intron
b) start codon
c) terminator
d) promoter
d. promoter
An operon consists of
a) a set of genes that encode proteins in a particular pathway
b) a promotor
c) an operator site
d) all of the above (a-c)
e) none of the above (a-c)
d. all of the above(a-c)
The means to inhibit the metabolism of alternative carbon sources by glucose is called
a) induction
b) epigenetic control
c) corepression
d) catabolite repression
d. catabolite repression
In the lac operon of Escherichia coli an RNA polymerase
a) binds to the promotor region
b) carries out transcription of three structural genes needed to metabolize lactose
c) is blocked by a repressor protein bound to the operator region when glucose is present
d) all of the above
d. all of the above
Mutations
a) are a permanent change in the nucleotide sequence of DNA
b) may be neutral, beneficial, or harmful
c) can be spontaneous
d) all of the above
d. all of the above
Of the 64 codons, how many encode specific amino acids?
a) all 64 codons
b) just 61 codons
c) just 32 codons
d) just 20 codons
b. just 61 codons
The process in which bacteria pass their genes to other species of bacteria is known as
a) mitosis
b) vertical gene transfer
c) horizontal gene transfer
d) crossing over
b. vertical gene transfer
The process by which cells take up DNA from the surrounding environment is called
a) conjugation
b) protoplast fusion
c) transformation
d) microinjection
c. transformation
What kind of damage is caused to DNA by ultraviolet radiation?
a) insertions and deletions
b) thymine dimers
c) nitrogenous base substitutions
d) DNA strand breaks
b. thymine dimers
Mutations in which one nucleotide pair is deleted or inserted in the DNA are called
a) nonsense mutations
b) frameshift mutations
c) point mutations
d) base-pair mutations
b. frameshift mutation
If a restriction enzyme makes a staggered cut in DNA, then ________ ends are created.
a) flat
b) sticky
c) beveled
d) blunt
b. sticky
Restriction enzymes are naturally produced by and isolated from
a) bacteria
b) bacteriophages
c) human cells
d) plant cells
a. bacteria
You have one copy of a small gene that you wish to amplify by the polymerase chain reaction (PCR). After 5 replication cycles, how many double-stranded DNA molecules do you have?
a) 16
b) 32
c) 64
d) thousands
b. 32
Which of the following places the steps of PCR in the correct order?
(1) Incubate at 94°C to denature DNA strands;
(2) Incubate at 72°C for DNA synthesis;
(3) Incubate at 60°C for primer hybridization.
a) 1, 2, 3
b) 3, 2, 1
c) 1, 3, 2
d) 2, 1, 3
c. 1, 3, 2
Which enzyme would cut this segment of DNA? GCATGAGTTCGGATCCCAATGC CGTACTCAAGCCTAGGGTTACG (a) BamHI ↓ GGATCC CCTAGG ↑ (b) EcoRI ↓ GAATTC CTTAAG ↑ (c) HaeIII ↓ GGCC CCGG ↑
a. BamHI
Which of the following are environmental factors that influence microbial growth?
a) oxygen
b) temperature
c) osmotic pressure
d) kinds and concentrations of nutrients
e) all of the above
e. all of the above
Oxygen
a) required for strictly aerobic bacteria
b) can be toxic or lethal to some organisms
c) toxicity mostly due to the production of superoxide radicals that are powerful oxidizing agents
d) aerobic bacteria can protect themselves but strict anaerobes can not
e) all of the above
a. required for strictly aerobic bacteria ?
Generation time can best be defined as:
a) the length of time it takes for lag phase
b) the duration of log phase
c) the time it takes for a cell to divide
d) how many generations a cell can divide
c. the time it takes for a cell to divide
Starting with one bacterial cell, how many cells would you have after 10 generations?
a) 20
b) 40
c) 1024
d) 2048
c. 1024
Bacteriostatic compounds
a) are biological or chemical agents that stop bacteria from reproducing
b) are biological or chemical agents that kill bacteria
c) create static electricity that inhibits the growth of bacteria
d) answers (a) and (c) are correct
a. are biological or chemical agents that stop bacteria from reproducing
Bactericidal compounds
a) are biological or chemical agents that stop bacteria from reproducing
b) are biological or chemical agents that kill bacteria
c) are suicidal compounds that become inactive over time
d) answer (b) and (c) are correct
b. are biological or chemical agents that kill bacteria
Antisepsis
a) killing harmful microorganisms on the surface of materials
b) killing bacteria that form endospores
c) destroying harmful microorganisms in living tissue
d) killing all microorganisms
c. destroying harmful microorganisms in living tissue
An isolated colony on a streak plate contains millions (or even billions) of identical cells that all grew from a single cell.
a) This is a false statement
b) This is partly false, because it takes more than one cell to form a colony
c) This is a true statement
d) This is almost correct, but the colony would only have hundreds (or thousands) of cells
c. this is a true statement
Which process converts one parental double-stranded DNA molecule to two identical offspring molecules?
a) transformation
b) transcription
c) replication
d) translation
c. replication
What molecule carries information that is used by ribosomes to make specific proteins?
a) mRNA
b) rRNA
c) tRNA
d) RNA polymerase
a. mRNA
Which is not true about autoclaving?
a) autoclaving requires steam under pressure
b) autoclaving requires maintaining steam at 121oC and 15 psi for 15 minutes
c) it is an effective way to pasteurize milk and other liquids
d) steam must come in contact with the surface of the substance being sterilized
c. it is an effective way to pasteurize milk and other liquids
A group of three nucleotides on mRNA is called a(n)
a) codon
b) anticodon
c) exon
d) intron
a. codon
An experiment began with 4 cells and ended with 128 cells. How many generations did the cells go through?
a) 32
b) 6
c) 5
d) 4
c. 5
Transformation is the transfer of DNA from a donor to a recipient cell
a) by a bacteriophage
b) as naked DNA in solution
c) by sexual reproduction
d) by crossing over
b. as naked DNA in solution
The process for gene transfer which requires cell-to-cell contact and a particular type of plasmid is called
a) conjugation
b) transduction
c) crossing over
d) transformation
a. conjugation
According to the operon model, for the synthesis of an inducible enzyme to occur, the
a) end-product must not be in excess
b) substrate must bind to the enzyme
c) substrate must bind to the repressor
d) repressor must not be synthesized
c. substrate must bind to the repressor
A gene is best defined as
a) any random segment of DNA
b) three nucleotides that code for an amino acid
c) a sequence of nucleotides in DNA that codes for a functional product
d) a sequence of nucleotides in RNA that codes for a functional product
e) the RNA product of a transcribed section of DNA
c. a sequence of nucleotides in DNA that codes for a functional product
Genetic change in bacteria can be brought about by
a) mutation
b) conjugation
c) transduction
d) transformation
e) All of the answers are correct
e. all of the answers are correct
Using the table at the right, determine the polypeptide encoded by the following sequence of nucleotides in this strand of mRNA
5’AUUACGCUUUGC3’
a) ileucine-arginine-lysine-alanine
b) isoleucine-threonine-leucine-cysteine
c) asparagine-cysteine-valine-serine
d) Translation would stop at the first codon.
e) The answer cannot be determined based on the information provided.
b. isoleucine-threonine-leucine-cysteine
The necessary ingredients for DNA synthesis can be mixed together in a test tube. The DNA polymerase is from Thermus aquaticus, and the template is from a human cell. The DNA synthesized would be most similar to
a) human DNA
b) T. aquaticus DNA
c) a mixture of human and T. aquaticus DNA
d) human RNA
e) T. aquaticus RNA
a. human DNA
A DNA molecule that transports foreign DNA into a cell is called a
a) clone
b) vector
c) nanosphere
d) mutagen
b. vector
Which technique amplifies small samples of DNA to quantities that are large enough for analysis?
a) hybridization
b) PCR
c) RFLP
d) DNA fingerprinting
b. PCR
Restriction enzymes are naturally produced by and isolated from
a) bacteria
b) bacteriophages
c) human cells
d) plant cells
a. bacteria
Which one of the following would NOT be used in a polymerase chain reaction (PCR)?
a) restriction enzymes
b) primers
c) target DNA
d) DNA polymerase
a. restriction enzymes
During transcription
a) DNA is replicated
b) a strand of messenger RNA is made that is complimentary to one of the DNA strands
c) an exact copy of a single DNA strand is made
d) a strand of messenger RNA is made that is complimentary to both of the DNA strands
b. a strand of messenger RNA is made that is complimentary to one of the DNA strands
c?
During transcription of DNA to make RNA the enzyme RNA polymerase
a) binds to a structural gene
b) binds to a so-called “promotor sequence” found in DNA
c) synthesizes a strand of RNA that is complimentary to mRNA
d) does all of the above
b. binds to a so-called “promotor sequences” found in DNA
The genetic code
a) can be thought of as consisting of ‘words’ that each have three letters encodes the amino
acid sequences of proteins
b) must be transcribed and translated to make proteins
c) is found in the specific order of nucleotides in DNA
d) all of the above
e) none of the above
d. all of the above
According to the base pairing rules of nucleic acids
a) A can pair with T
b) A can pair with U
c) A can pair with G
d) A can pair with A
e) (a) and (b) are both correct
e. (a) and (b) are both correct
Transcription of DNA
a) results in replication of DNA
b) results in synthesis of messenger RNA
c) results in a protein
d) results in regulation of gene expression
e) none of the above
b. results in synthesis of messenger RNA
A codon
a) is a sequence of three nucleotides that can be translated into a specific amino acid
b) is a sequence found in mRNA that is complimentary to an anticodon
c) is a single sequence of DNA that encodes a single protein
d) is a sequence of three nucleotides that determines where RNA polymerase binds to DNA
e) (a) and (b) are both correct
a. is a sequence of three nucleotides that can be translated into a specific amino acid
Horizontal gene transfer
a) can occur by plasmid transfer during conjugation
b) only occurs when DNA is transferred between two cells that are genetically identical
c) occurs when two bacterial cells are horizontal to one another so the end of one cell is in
contact with the end of another cell.
d) only occurs when DNA in the environment is taken up by a bacterial cell
b. only occurs when DNA is transferred between two cells that are genetically identical
Which of the following are considered to be frameshift mutations?
a) insertions only
b) missense mutations
c) deletions only
d) both missense mutations and insertions
e) both deletions and insertions
e. both deletions and insertions
If the codon AAA is changed to AAG, it still codes for the amino acid lysine; this is an example of a
a) radical mutation
b) nonsense mutation
c) frameshift mutation
d) dimer formation
e) missense mutation
e. missense mutation
Which of the following causes mutations by creating thymine dimers?
a) nucleotide analogs
b) nitrous acid
c) ultraviolet light
d) benzopyrene
e) gamma rays
c. ultraviolet
Mutations
a) can be beneficial
b) are almost never found in a laboratory culture of bacteria
c) are usually repaired by enzymes
d) usually prevent the synthesis of a protein
a. can be beneficial
Restriction enzymes
a) ‘cut’ DNA at random locations in DNA
b) ‘cut’ DNA at specific locations in DNA
c) all ‘cut’ the same sequence of DNA even though they are found in different bacteria
d) only ‘cut’ DNA from bacteria
b. ‘cut’ DNA at specific locations in DNA
The primers used in the polymerase chain reaction
a) specifically recognize DNA polymerase
b) bind to specific sequences in the DNA template
c) only bind to DNA when the temperature is high
d) all of the above are true
b. bind to specific sequences in the DNA template
The amplification of DNA using the polymerase chain reaction
a) is used to detect trace amounts of DNA
b) is used in forensics
c) is used to detect pathogenic bacteria in food samples
d) is used to make interesting television shows
e) All of the above are true
c. is used to detect pathogenic bacteria in food samples
Codons are recognized during
a) translation
b) transcription
c) base excision
d) DNA replication
e) transduction
a. translation
Genetic elements known as promoters are initiation points for the process of DNA replication
a) transcription
b) translation
c) mutation repair
d) transformation
a. transcription
Which of the following statements about smooth and rough variants of Streptococcus pneumoniae is true?
a) neither cause disease
b) both cause disease
c) a substance from the ‘rough’ variant transforms ‘smooth’ variants into a form that causes
disease
d) they were used by Griffith to show that DNA was responsible for transforming avirulent
Streptococcus pneumoniae into virulent Streptococcus pneumoniae
c. a substance from the ‘rough’ variant transforms ‘smooth’ variants into a form that causes
disease
Genetic change in bacteria can be brought about by
a) mutation
b) conjugation
c) transduction
d) transformation
e) All of the answers are correct
e. all of the answers are correct
Which of the following is involved in translation?
a) rRNA only
b) tRNA only
c) mRNA only
d) both mRNA and tRNA
e) mRNA, rRNA and tRNA are all involved
e. mRNA, rRNA, and tRNA are all involved
A gene is best defined as
a) any random segment of DNA.
b) three nucleotides that code for an amino acid.
c) a sequence of nucleotides in DNA that codes for a functional product
d) a sequence of nucleotides in RNA that codes for a functional product
e) the RNA product of a transcribed section of DNA.
c. a sequence of nucleotides in DNA that codes for a functional product
A codon
a) is a sequence of three nucleotides that can be translated into a specific amino acid
b) is a sequence found in mRNA that is complimentary to an anticodon
c) is a single sequence of DNA that encodes a single protein
d) is a sequence of three nucleotides that determines where RNA polymerase binds to DNA
e) (a) and (b) are both correct
a. is a sequence of three nucleotides that can be translated into a specific amino acid
GUA UAC UGG GCA GGA What will be the amino acid sequence of the polypeptide made when this mRNA is translated (see table)? a) Val-Tyr-Trp-Thr-Gly b) Val-Tyr-Trp-Ala-Gly c) both (a) and (b) d) neither (a) or (b)
b. Val-Tyr-Trp-Ala-Gly
The process of bacteria passing their genes to other microbes of the same generation is known as
a) mitosis.
b) vertical gene transfer.
c) horizontal gene transfer.
d) crossing over.
c. horizontal gene transfer
The procedure during which cells can take up DNA from the surrounding environment is called
a) conjugation.
b) protoplast fusion.
c) transformation.
d) microinjection.
c. transformation
