The Human and Oral Microbiomes Flashcards
what is a habitat?
specific site of organism growth
what is a microbial community?
the micro-organisms that are present in a given habitat
What is microbiota?
the total collection of micro-organisms within a microbial community
what is microbiome?
The microbiota and all of its associated genes.
what is the metagenome?
the total genomic DNA of all the organisms within a community
what is a biofilm?
A physically (often temporally) structured aggregate of micro-organisms, adhered to each other and/or a defined substrate (ie. dental plaque attached to a tooth/gum margin).
What is the human microbiome made up of?
“we are an organism made up of numerous mutually interdependent smaller organisms and their genomes ”.
* There are 10X moremicrobial cells in the human bodythan human cells
* 10,000 The number of different species identified to-date within the human body
* ~ 22,000 The number of genes in the human genome
* 3.3 million The number of genes in the human gut microbiome
Why is the human microbiome is important?
- Health: Specific microorganisms are protective against disease, and pathogenic bacterial species
- Disease: changes in the composition of the microbiome are associated with disease. Examples: Inflammatory Bowel Disease, Obesity, Diabetes, Rheumatoid Arthritis
- Microbial Genes: Modulate fundamental human physiological processes. Examples: Metabolism, Energy acquisition, Immune modulation, Neurological development
what are two methods to study the microbiome?
- The Traditional Culture Approach
- The New Molecular Approach
how do you carry out a The Traditional Culture Approach?
Grow microbes directly from sample
Requires phenotypic identification of isolates:
* Morphology / Motility
* Biochemical
* Antibody / Serological
* Metabolic
how do you carry out the new molecular approach?
- Identifies organisms by gene sequence homology
- Extract microbial DNA from samples
- Sequence analysis of DNA by targeted sequencing (16s rRNA) or Shotgun Metagenomics sequencing
what are the positives of the traditional cultivation approach?
cheap
what are the negative of the traditional cultivation approach?
- Labour intensive [> 24 hours for org ID]
- Only gross species discrimination possible
- Not many species can grow (only 50% of known oral bacteria are currently cultivable in the laboratory)
- Need to know what species to expect to be able to use the right growth conditions for them.
what are the positives of the new molecular approach?
- Tells you what is present not just what you can grow
- Can tell you what genes are present able to determine whether a particular bacteria is pathogenic or not
- Higher discriminatory power for species identification
what are the negatives of the new molecular approaches?
- Sequence bias due to primer specificity
- Expensive
- Time consuming and Computational taxing
what is the 16s rRNA gene?
- 1542 bp gene
- Encodes the small subunit of the ribosomal complex, necessary for protein synthesis
why target the 16s rRNA gene?
- Found in all bacteria and archaea
- Because the gene has an essential function it also has a highly specific highly conserved regions that do not vary. But between there is a regions that are highly variable which allow for discrimination of bacterial genera.
- “molecular clock” – rDNA sequence similarities correlated with ‘evolutionary relatedness’. Little evidence of horizontal gene transfer
what is shotgun metagenomics?
- Is the study of uncultured microbial communities, typically relying on high-throughput experimental data and bioinformatic techniques
- Sequences whole genes. (ie. Sequences all genes present in the sample not just 16S rRNA)
what are the positives of shotgun metagenomics?
- Covers all kingdoms, not just Bacteria and Archaea (even human genes)
- Gives both functional and taxonomic information
- More technical and expensive
How to make sense of sequencing data ?
Sequence output is a list of A, T, G, C’s
‘ATGCATCGATCGTACTGACTATGCATATAGTTCA’
Comparison of A, T, G, C’s to curated databases for identification:
* 16S rRNA database for taxonomic identification (2011 green genes database contains 1,049,116 aligned 16S rDNA records >1250nt)
* Genome databases for metagenomics (ie. Database of all know genes of interest)
what are the limitations of sequencing data?
- Can only identify sequences present in our databases
- Need to perform whole genome sequencing of more organisms so this genetic information can be added to the databases
- Need to annotate the sequences. Ie. What do the ATCG’s code for? What is their function?
what is the importance of annotation?
- Makes sense of the A, T, G, C’s
- Identifies the open reading frame (ORF) of genes
- Predicts putative functions for genes and gene products
what are the issues with annotation?
- Its only a prediction. Need confirmation experiments
- Takes about 100 hours per genome (1 minute/gene)
- Mistakes are made
- Various software available to help predict function of genes. Some are better than others
- Genes shared and vary between species
when does colonisation occur in humans?
Colonisation begins at birth. Microbiome changes over time. Most dramatically in the first 3 years of life. Influenced by diet, lifestyle, environment.
what is the microbiome like in the stomach?
Traditionally always thought to be sterile. Any colonisation in the stomach was thought to be transient as it was due to being brought by food.
Helicobacter pylori is a coloniser:
* Associated with gastritis and ulcers and stomach cancer
* Up to 40% of the population colonised by this bacteria.
what is the microbiome like in the small intestine?
- There are a lower numbers of organisms but the number increases closer to the colon
- Microbes found here are those which have passed through stomach acid without being killed.
- Include Streptococcus Spp. And Lactobacillus Spp. and yeasts.
- All are aciduric (acid-tolerating)
what is the microbiome like in the colon/large intestine?
- Heavily populated with highly varied bacterial genera
- Anaerobic microbes greatly outnumber the aerobic and facultative microbes
- Heavily studied for health and disease assocaitions
what is the microbiome like in the skin?
- Varied microbiota - Large variation between different sites
- Relatively low numbers of microbes on exposed areas because of the fact these areas are continuously abraded.
- Large numbers present in protected areas e.g. axilla, groin, between toes
- Large numbers also present around orifices
- Principal species include those associated with skin conditions such as acne
what is the microbiome like in the mouth?
High numbers of bacteria in the mouth:
* ~108/ml in saliva
* ~109/mg in plaque
Highly diverse more than 700 species identified in the oral cavity.
is the oral microbiome in harmony with its host?
no, The oral microbiome is usually associated with oral diseases.
why is the oral microbiome not in harmony with its host?
may be due to our oral hygiene where we are constantly brushing away oral bacteria so the oral biofilm never settles down to a particular static community.
what is the most dominant species in the saliva
Streptococcus
what bacteria in mouth is considered healthy?
Streptococcus and actinomyces
what bacteria in the mouth is associated with gingivititis?
Fusobacterium*
what bacteria in the mouth is associated with periodontitis?
Prevotella and Spirochaetes
what are the dynamic changes in Plaque Microbiota due to Disease?
Aerobic cocci, some aerobic bacilli Mostly healthy
Aerobic cocci, more aerobic bacilli. New cocci genera appearing Mostly healthy
Gram-negative anaerobic species appear – Gingivitis associated
Gram-negative anaerobic species begin to dominate. Gingivitis and Periodontitis associated
why is microbiota essential for health?
- Required for development of gut structures and the immune system
- Protects against colonisation with pathogens – colonisation resistance
- Disruption of normal microbiota e.g. by antibiotics leads to infection bypathobionts e.g. Candida spp
what is dysbiosis?
an imbalance in the host microbiota
how can dysbiosis occur?
Can result in development of both infectious and non-infectious diseases.
what are the environmental factors that drive dysbiosis?
- (mal)nutrition
- antibiotics consumption
- infection
what is the impact of post-genomic microbiology research on dentistry?
- A greater understanding of dental diseases - Prevention and restoration
- Improved diagnosis, we know what species are present in the saliva could lead to more rapid and accurate diagnosis and maybe earlier intervention, broader range
- Novel antimicrobial drugs, which can improve our repertoire of antibiotics for use on treating infection
