The Human and Oral Microbiomes Flashcards
(41 cards)
what is a habitat?
specific site of organism growth
what is a microbial community?
the micro-organisms that are present in a given habitat
What is microbiota?
the total collection of micro-organisms within a microbial community
what is microbiome?
The microbiota and all of its associated genes.
what is the metagenome?
the total genomic DNA of all the organisms within a community
what is a biofilm?
A physically (often temporally) structured aggregate of micro-organisms, adhered to each other and/or a defined substrate (ie. dental plaque attached to a tooth/gum margin).
What is the human microbiome made up of?
“we are an organism made up of numerous mutually interdependent smaller organisms and their genomes ”.
* There are 10X moremicrobial cells in the human bodythan human cells
* 10,000 The number of different species identified to-date within the human body
* ~ 22,000 The number of genes in the human genome
* 3.3 million The number of genes in the human gut microbiome
Why is the human microbiome is important?
- Health: Specific microorganisms are protective against disease, and pathogenic bacterial species
- Disease: changes in the composition of the microbiome are associated with disease. Examples: Inflammatory Bowel Disease, Obesity, Diabetes, Rheumatoid Arthritis
- Microbial Genes: Modulate fundamental human physiological processes. Examples: Metabolism, Energy acquisition, Immune modulation, Neurological development
what are two methods to study the microbiome?
- The Traditional Culture Approach
- The New Molecular Approach
how do you carry out a The Traditional Culture Approach?
Grow microbes directly from sample
Requires phenotypic identification of isolates:
* Morphology / Motility
* Biochemical
* Antibody / Serological
* Metabolic
how do you carry out the new molecular approach?
- Identifies organisms by gene sequence homology
- Extract microbial DNA from samples
- Sequence analysis of DNA by targeted sequencing (16s rRNA) or Shotgun Metagenomics sequencing
what are the positives of the traditional cultivation approach?
cheap
what are the negative of the traditional cultivation approach?
- Labour intensive [> 24 hours for org ID]
- Only gross species discrimination possible
- Not many species can grow (only 50% of known oral bacteria are currently cultivable in the laboratory)
- Need to know what species to expect to be able to use the right growth conditions for them.
what are the positives of the new molecular approach?
- Tells you what is present not just what you can grow
- Can tell you what genes are present able to determine whether a particular bacteria is pathogenic or not
- Higher discriminatory power for species identification
what are the negatives of the new molecular approaches?
- Sequence bias due to primer specificity
- Expensive
- Time consuming and Computational taxing
what is the 16s rRNA gene?
- 1542 bp gene
- Encodes the small subunit of the ribosomal complex, necessary for protein synthesis
why target the 16s rRNA gene?
- Found in all bacteria and archaea
- Because the gene has an essential function it also has a highly specific highly conserved regions that do not vary. But between there is a regions that are highly variable which allow for discrimination of bacterial genera.
- “molecular clock” – rDNA sequence similarities correlated with ‘evolutionary relatedness’. Little evidence of horizontal gene transfer
what is shotgun metagenomics?
- Is the study of uncultured microbial communities, typically relying on high-throughput experimental data and bioinformatic techniques
- Sequences whole genes. (ie. Sequences all genes present in the sample not just 16S rRNA)
what are the positives of shotgun metagenomics?
- Covers all kingdoms, not just Bacteria and Archaea (even human genes)
- Gives both functional and taxonomic information
- More technical and expensive
How to make sense of sequencing data ?
Sequence output is a list of A, T, G, C’s
‘ATGCATCGATCGTACTGACTATGCATATAGTTCA’
Comparison of A, T, G, C’s to curated databases for identification:
* 16S rRNA database for taxonomic identification (2011 green genes database contains 1,049,116 aligned 16S rDNA records >1250nt)
* Genome databases for metagenomics (ie. Database of all know genes of interest)
what are the limitations of sequencing data?
- Can only identify sequences present in our databases
- Need to perform whole genome sequencing of more organisms so this genetic information can be added to the databases
- Need to annotate the sequences. Ie. What do the ATCG’s code for? What is their function?
what is the importance of annotation?
- Makes sense of the A, T, G, C’s
- Identifies the open reading frame (ORF) of genes
- Predicts putative functions for genes and gene products
what are the issues with annotation?
- Its only a prediction. Need confirmation experiments
- Takes about 100 hours per genome (1 minute/gene)
- Mistakes are made
- Various software available to help predict function of genes. Some are better than others
- Genes shared and vary between species
when does colonisation occur in humans?
Colonisation begins at birth. Microbiome changes over time. Most dramatically in the first 3 years of life. Influenced by diet, lifestyle, environment.
