Phys Comp 2 Flashcards
Pick the correct sequence of anti codons that match this DNA sequence…AATCGAGTACATTGGAATACDA
C. AAUCGAGUACAUUGGAAUACA
Pick the smallest in size.
nucleotide (verify)
Nerve signals indicate the intensity of the stimulus by the ???
frequency of action potentials
Lipids
are insulators
a hydrophilic substance
dissolves in water
the site for protein synthesis is
rough endoplasmic reticulum
the site of lipid synthesis
smooth endoplasmic reticulum
The lease desirable source of energy for body cells is
protein
reticular formation is located in the ????
brainstem
a neutral atom as 16 electrons. This atom should typically contain ___ protons?
16
ipsp’s can result from the influx of ____ions into the cell
chloride
abnormally low muscle tone is referred to as
hypotonia
A solution A is more acidic than B…this means that solution A…
has a lower Ph
which of the following body fluid compartments has the largest volume?
intracellular fluid
adipose tissue is a type of
connective tissue
if a cell membrane becomes more permeable to chloride ions, chloride will…
enter the cell
In a healthy cell, DNA is only found in the
nucleus
a hypertonic cell is placed in pure water, this cell would initially
remain the same size
the normal physiological Ph of arterial blood is approximately
7.4
pick the correct sequence of events in the process protein decomposition
D. amino acids - peptides - dipeptides - polypeptides - protein