Phys Comp 2

Question 1

Pick the correct sequence of anti codons that match this DNA sequence…AATCGAGTACATTGGAATACDA

Answer 1

C. AAUCGAGUACAUUGGAAUACA

Question 2

Pick the smallest in size.

Answer 2

nucleotide (verify)

Question 3

Nerve signals indicate the intensity of the stimulus by the ???

Answer 3

frequency of action potentials

Question 4

Lipids

Answer 4

are insulators

Question 5

a hydrophilic substance

Answer 5

dissolves in water

Question 6

the site for protein synthesis is

Answer 6

rough endoplasmic reticulum

Question 7

the site of lipid synthesis

Answer 7

smooth endoplasmic reticulum

Question 8

The lease desirable source of energy for body cells is

Answer 8

protein

Question 9

reticular formation is located in the ????

Answer 9

brainstem

Question 10

a neutral atom as 16 electrons. This atom should typically contain ___ protons?

Answer 10

16

Question 11

ipsp’s can result from the influx of ____ions into the cell

Answer 11

chloride

Question 12

abnormally low muscle tone is referred to as

Answer 12

hypotonia

Question 13

A solution A is more acidic than B…this means that solution A…

Answer 13

has a lower Ph

Question 14

which of the following body fluid compartments has the largest volume?

Answer 14

intracellular fluid

Question 15

adipose tissue is a type of

Answer 15

connective tissue

Question 16

if a cell membrane becomes more permeable to chloride ions, chloride will…

Answer 16

enter the cell

Question 17

In a healthy cell, DNA is only found in the

Answer 17

nucleus

Question 18

a hypertonic cell is placed in pure water, this cell would initially

Answer 18

remain the same size

Question 19

the normal physiological Ph of arterial blood is approximately

Answer 19

7.4

Question 20

pick the correct sequence of events in the process protein decomposition

Answer 20

D. amino acids - peptides - dipeptides - polypeptides - protein