Lecture 12: Translation Flashcards
How many steps are in translation? Describe them
- there are four steps:
- Step 1: ribosome attaches to mRNA
- Step 2: ribosomes find AUG in mRNA
- Step 3: ribosome brings the tRNAs needed
- Step 4: ribosome reaches a stop
What is mRNA?
messenger RNA
What moves during translation: the mRNA or the ribosomes?
the ribosomes
What does AUG signal?
to start translating
What is tRNA? What is their function?
- transfer RNA
- they are the actual translator that convert nucleotides to amino acids
Do tRNAs carry a specific amino acid? Give an example
Yes, AUG=Met
What links the different amino acids that make a protein?
Peptide Bonds
What is the name of the three nucleotides set?
codon
How does the ribosome stop translating
with a signal of a stop codon
Transcribe and Translate the following: (you may use the chart)
TACGGGTATACGTACTAACCGATT
-TRANSCRIPTION: AUGCCCAUAUCGAUGAUUGGCUAA
-TRANSLATION:
Met Pro Ile Cys Met Ile Gly (stop)