Genetics Test 2 Ch. 9

Question 1

1) What features of proteins does two- dimensional gel electrophoresis exploit in order to separate proteins?<br></br>A) charge and pH<br></br>B) shape and size<br></br>C) pH and polarity<br></br>D) charge and shape<br></br>E) size and charge

Answer 1

Answer: E

Question 2

2) The Shine- Dalgarno sequence in bacteria ________.<br></br>A) is a region of the tRNA molecule involved in formation of charged tRNAs <br></br>B) is a purine- rich consensus sequence found in the 5ȝ UTR of the mRNA<br></br>C) is a consensus sequence involved in the termination of translation<br></br>D) is a pyrimidine- rich consensus sequence found in the 3ȝ UTR of the mRNA <br></br>E) is a purine- rich consensus sequence found in the 16S rRNA subunit

Answer 2

Answer: B

Question 3

3) During translation initiation in bacteria, the amino acid on the initiator tRNA is ________. <br></br>A) N- formylmethionine (fMet)<br></br> B) IF- 1<br></br>C) methionine (Met)<br></br>D) added using ATP as the energy source <br></br>E) acetylated

Answer 3

Answer: A

Question 4

4) Identification of ribosomal proteins involves two- dimensional gel electrophoresis, which separates the proteins on the basis of ________.<br></br>A) charge<br></br>B) mass and charge <br></br>C) C) folded shape<br></br>D) mass<br></br>E) mass, charge, and folded shape

Answer 4

Answer: B

Question 5

5) How does the eukaryotic initiation complex locate the correct start codon?<br></br>A) The initiation complex moves the small ribosomal subunit through the 5ȝ UTR, scanning for the start AUG.<br></br>B) The correct start codon is the first ATG encountered downstream of the Kozak sequence.<br></br>C) The pre- initiation complex moves the ribosome through the 3ȝ UTR, scanning for the Kozak sequence.<br></br>D) The correct start codon is the formyl- ATG, which will encode for fMet in the protein.<br></br>E) The true start codon is the first ATG encountered downstream of the Shine- Dalgarno sequence.

Answer 5

Answer: A

Question 6

6) What is the cellular location of the stages of translation in bacteria and eukaryotes? 6)<br></br>A) cytosol for bacteria and eukaryotes<br></br>B) membrane for bacteria and cytosol and rough ER for eukaryotes<br></br>C) cytosol for bacteria and cytosol, mitochondrion, and plastid for eukaryotes<br></br>D) nucleoid for bacteria and rough ER for eukaryotes E) cytosol for bacteria and nucleus for eukaryotes

Answer 6

Answer: C

Question 7

7) How does the eukaryotic ribosomal small subunit recognize the start codon on the mRNA? <br></br>A) It binds an Met- tRNA to the first AUG codon it encounters.<br></br>B) It binds an Met- tRNA to the first AUG codon after the Kozak sequence.<br></br>C) It performs an ATP hydrolysis within the small subunit once it encounters a Met- tRNA already bound to the AUG.<br></br>D) It undergoes a conformational charge that recruits other proteins when it hydrogens bonds to the correct tri- nucleotide sequence.<br></br>E) It wraps the mRNA strand to bring initiation enhancer proteins into the vicinity of the start codon.

Answer 7

Answer: B

Question 8

8) A tRNA in the P site of the ribosome will enter the ________ site after translocation of the ribosome.<br></br> A) A B) initiation C) řȝ D) śȝ E) E

Answer 8

Answer: E

Question 9

śȝ GACCAUUUUUGA 3ȝ<br></br>If a tRNA with a Phenylalanine amino acid attached is in the P site of the ribosome, an empty tRNA present in the E site that delivered which amino acid?<br></br>A) serine<br></br>B) proline<br></br>C) aspartic acid<br></br>D) tyrosine<br></br>E) histidine

Answer 9

Answer: E

Question 10

śȝ GACCAUUUUUGA 3ȝ<br></br>In the polypeptide produced, what amino acid will be attached to the amino group of the histidine encoded by this mRNA?<br></br>A) aspartic acid<br></br>B) proline<br></br>C) tyrosine<br></br>D) phenylalanine<br></br>E) serine

Answer 10

Answer: A

Question 11

11) What would you expect to find bound to the stop codon at the A site?<br></br>A) a charged tRNA with the anticodon ATC<br></br>B) a charged tRNA with the anticodon TAG<br></br>C) an uncharged tRNA<br></br>D) a translation release factor<br></br>E) Nothing binds to a stop codon, which is why the peptide is released.

Answer 11

Answer: D

Question 12

12) What is necessary for a eukaryotic RNA to be recognized and bound by the small subunit of the ribosome?<br></br>A) Sufficiently large 5’ UTR for ribosome scanning.<br></br>B) Presence of an AUG start codon near the 5’ end of the mRNA.<br></br>C) Formation of the pre- initiation complex before ribosome binding.<br></br>D) Presence of 5’ methyl- G cap on the mRNA.<br></br>E) Formation of the initiation complex before ribosome binding.

Answer 12

Answer: D

Question 13

13) Elongation factors translocate the ribosome in the 3ȝ direction by a distance of ________. <br></br>A) one nucleotide<br></br>B) two nucleotides<br></br>C) two codons<br></br>D) one codon<br></br>E) three codons

Answer 13

Answer: D

Question 14

A polycistronic mRNA contains multiple? <br></br>A) mRNAs<br></br>B) promoters<br></br>C) Kozak sequences<br></br>D) Shine- Dalgarno sequences<br></br>E) polypeptide- encoding sequences

Answer 14

Answer: E

Question 15

15) Why are eukaryotic mRNAs not polycistronic, unlike some bacterial transcripts?<br></br>A) The eukaryotic ribosome must bind to the 5’ end of the mRNA and scan, while the bacterial ribosome can bind to a Shine- Delgarno sequence anywhere in the mRNA.<br></br>B) Bacteria couple their translation with transcription, while eukaryotes do not.<br></br>C) Eukaryote’s genetic code is non- overlapping, and so coding sequences cannot overlap on the same mRNA.<br></br>D) Eukaryotes have more complex translational machinery than bacteria that is also less efficient in initiating translation.<br></br>E) Eukaryotic mRNAs are generally shorter than bacteria mRNAs, and so do not contain sufficient information to encode additional polypeptides.

Answer 15

Answer: A

Question 16

16) What does it mean for two codons to be synonymous?<br></br>A) They share one of the same nucleotides in their codon sequence.<br></br>B) They share two of the same nucleotides in their codon sequence.<br></br>C) They are adjacent on the mRNA.<br></br>D) They encode the same amino acid.<br></br>E) They occur in equal abundance in an mRNA sequence.

Answer 16

Answer: D

Question 17

17) What result would you expect if a mutation eliminates one of the four arms of a tRNA? <br></br>A) The tRNA will not be recognized by tRNA synthetase and cannot be charged.<br></br>B) The tRNA will fit into the A site but will not release the peptide at the P site.<br></br>C) The tRNA will be charged with the wrong amino acid.<br></br>D) The tRNA will not be able to undergo traditional complementary base pairing.<br></br>E) There will be no effect on function, so long as the anticodon region is intact.

Answer 17

Answer: A

Question 18

18) How many different aminoacyl- tRNA synthetases can be found in a given organism’s cells? <br></br>A) At least 20, or more depending on the organism<br></br>B) 16<br></br>C) 61<br></br>D) 20<br></br>E) The number varies greatly depending on the organisms type.

Answer 18

Answer: A

Question 19

19) If a tRNA anticodon were mutated such that it no longer performed wobble, what would be the effect on encoded proteins?<br></br>A) A different amino acid would consistently replace the amino acid whose tRNA was mutated.<br></br>B) Many proteins would be truncated.<br></br>C) The rate of protein synthesis would be slowed.<br></br>D) Many proteins would have several mutated amino acids throughout their sequence.<br></br>E) The ribosome would be unable to translate proteins.

Answer 19

Answer: B

Question 20

20) A mutagen has introduced a frame- shift mutation by adding one nucleotide base. Which of the following could be a reversion mutation for this particular mutant?<br></br>A) adding 1 base only<br></br>B) deleting 1 base or adding 1 base<br></br>C) deleting 1 base or adding 3 bases<br></br>D) deleting 2 bases only<br></br>E) deleting 1 base or adding 2 bases

Answer 20

Answer: E

Question 21

21) Which of these choices represents one possible corresponding mRNA sequence that can be transcribe from the following DNA template?<br></br>śȝ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3ȝ<br></br>A) śȝ - ATG CGA TTT GGG TGC TAG - 3ȝ<br></br>B) śȝ - AUG CGA UUU GGG UGC UAG - 3ȝ C) śȝ - AUG CGA UUU GGG UGC - 3ȝ<br></br>D) řȝ - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5ȝ<br></br>E) śȝ - CTA GCA CCC AAA TCG CAT TAG - 3ȝ

Answer 21

Answer: B

Question 22

22) Given the following mRNA sequence, what is the amino acid sequence for the corresponding polypeptide?<br></br>śȝ - AUG CGA UUU GGG UGC UAG - 3ȝ<br></br>A) N-Arg- Phe- Gly- Stop-C<br></br>B) N-Met- Arg- Phe- Gly- Stop-C<br></br>C) śȝ- Met- Arg- Phe- Gly- Stop- řȝ<br></br>D) C-Met- Arg- Leu- Glu-N<br></br>E) N-Met- Asp- Phe- Gly- Trp-C

Answer 22

Answer: B

Question 23

23) Given the following mRNA sequence, which of the following mRNAs would encode a protein with a different sequence of amino acids?<br></br>śȝ - AUG CAG UUA GCG UGC UAG - 3ȝ<br></br>A) śȝ - AUG CAG UUG GCG UGC UAG - 3ȝ<br></br>B) śȝ - AUG CAC UUA GCA UGC UAG - 3ȝ<br></br>C) śȝ - AUG CAG UUA GCA UGC UAG - 3ȝ<br></br>D) śȝ - AUG CAA UUA GCG UGU UAG - 3ȝ E) śȝ - AUG CAA UUA GCG UGC UAG - 3ȝ

Answer 23

Answer: B

Question 24

24) Which mRNA below would code for a premature stop codon from the following amino acid sequence?<br></br>N—Met- Gln- Leu- Arg- Cys—C<br></br>A) śȝ - AUG AAG UUA GCG UGC UAG - 3ȝ B) śȝ - AUG CAG UUA GCG UGC AAG - 3ȝ<br></br>C) śȝ - AUG CAG UAA GCG UGC UAG - 3ȝ<br></br>D) śȝ - AUG CAG UUA UUG UGC UAG - 3ȝ E) śȝ - AUG CAG AUA GCG UGC UAG - 3ȝ

Answer 24

Answer: C

Question 25

25) How might a single base INSERTION into the second codon of the coding sequence of a gene affect the amino acid sequence of a protein encoded by the gene? A) A single amino acid could change.<br></br> <br></br>B) The mutation may have no effect on amino acid sequence.<br></br>C) The amino acid sequence would be changed.<br></br>D) A single extra amino acid would be present in the protein.<br></br>E) All of the above are possible outcomes.

Answer 25

Answer: C

Question 26

26) You have identified a bacterial protein that has retained the starting fMet in its protein sequence. Which of the following is likely true of this protein?<br></br>A) It is likely nonfunctional, since bacteria use posttranslational cleavage of fMet to make<br></br>functional proteins.<br></br>B) It will be a functional bacterial protein, since all functional proteins must begin with fMet. <br></br>C) It will be not be able to be chemically modified, so it will be sent to the Golgi for secretion.<br></br>D) It will show improper protein sorting and will likely remain in the ER.<br></br>E) It will likely form a disulfide bond with a second peptide chain, forming a protein complex.

Answer 26

Answer: A

Question 27

27) How is a tRNA able to recognize its proper mRNA codon?<br></br>A) Hydrogen bonding between the ribosomal subunits and the mRNA creates the proper active site conformation to allow tRNA binding.<br></br>B) Complementary hydrogen bonding between tRNA and mRNA promote binding.<br></br>C) The amino acid on the tRNA recognizes the mRNA codon through hydrogen and ionic bonding.<br></br>D) Ionic bonds between the tRNA and the active site of the ribosomal subunits promote binding to the mRNA.<br></br>E) Appropriate shape of the tRNA allows it to fit onto the extended mRNA strand.

Answer 27

Answer: B

Question 28

28) If the first nucleotide in a codon is mutated to a different nucleotide, what would be the effect on the encoded protein?<br></br>A) A missense mutation from one encoded amino acid changing to another.<br></br>B) It depends on what the changed nucleotide is.<br></br>C) A frameshift mutation for all of the subsequent amino acids in the protein.<br></br>D) No effect as the problem nucleotide would be corrected by RNA editing mechanisms.<br></br>E) A silent mutation and no change in the encoded amino acid.

Answer 28

Answer: B

Question 29

29) In the unlikely event that a tRNA has been charged with the wrong amino acid, which high- fidelity enzyme most likely caused the incorrect charging?<br></br>A) DNA polymerase I<br></br>B) aminoacyl synthetase <br></br>C) aminoacyl peptidase<br></br>D) peptidyl transferase<br></br>E) DNA polymerase III

Answer 29

Answer: B

Question 30

30) If the genetic code were overlapping, how many complete codons would the following sequence 30) encode before encountering a stop codon? śȝ - AUGCGAUUAAAGUGC - 3ȝ<br></br>A) 10 B) 13 C) 8 D) 6 E) 4

Answer 30

Answer: C