final prep Flashcards by Julia Carr

Which of the following monosaccharides is an aldose?
  Dihydroxyacetone 
  Glyceraldehyde 
  Glucose 
  Lactose

Both B and C

How well did you know this?

Not at all

Perfectly

When two monosaccharides are epimers:
They differ only in the configuration about one carbon atom
One is a furanose, the other a pyranose
One is an aldose, the other a ketose
They can form ring structures
They form O-glycosidic bonds

They differ only in the configuration about one carbon atom

How well did you know this?

Not at all

Perfectly

Which pair is anomeric?
A) D-ribose and D-galactose
B) α-D-allose and β-D-allose
C) D-Ribose and L-fructose
D) D-glucose and L-glucose
E) α-D-idose and β-L-idose

How well did you know this?

Not at all

Perfectly

When forming the disaccharide maltose from two glucose monosaccharides:
Gas is eliminated
A condensation reaction occurs
An anomeric carbon is formed on carbon-1
An epimer is formed
A polysaccharide is formed

A condensation reaction occurs

How well did you know this?

Not at all

Perfectly

Amylose and amylopectin are both polymers of:

A) α-D-glucose
B) β-D-glucose
C) Galactose
D) Idose
E) Maltose

How well did you know this?

Not at all

Perfectly

Which statement about starch and glycogen is false?

A) Both have β-D-glucose monomers
B) Both starch and glycogen are energy storage polysaccharides
C) Both are homopolymers of glucose
D) Glycogen is more extensively branched than starch
E) Both have O-glycosidic linkages

How well did you know this?

Not at all

Perfectly

Which monosaccharide is not a six-carbon monosaccharide?
  Idose 
  Gulose 
  Galactose 
  Dihydroxyacetone 
  Allose

Dihydroxyacetone

How well did you know this?

Not at all

Perfectly

Which statement about cellulose is true?
Cellulose is found in plants
Cellulose is the primary storage polysaccharide of animal cells
Cellulose is found in DNA
The glucose residues of cellulose contain the same configuration as the glucose residues of amylose
Cellulose is an epimer of chitin

How well did you know this?

Not at all

Perfectly

The polysaccharide chitin is most chemically similar to:
 Cellulose 
  Dextrose 
  Glycogen 
  Starch 
  Amylose

Cellulose

How well did you know this?

Not at all

Perfectly

Which of the following is the most common monosaccharide on earth?
  Ribose 
  Cellulose 
  Chitin 
  Sucrose 
  Glucose

Glucose

How well did you know this?

Not at all

Perfectly

The “D” in the D-carbohydrates stands for:
  3-dimensional 
  Dextrorotatory 
  Derivative 
  Design 
  Double

Dextrorotory

How well did you know this?

Not at all

Perfectly

Which compound does not fit the formal definition of a carbohydrate?

A. C6H12O6

B. C9H18O9

C. C3H6O3

D. C8H14O8

E. C5H10O5

How well did you know this?

Not at all

Perfectly

Table sugar is also known as:
  Sucrose 
  Dextrose 
  Glucose 
  Galactose 
  Glycogen

Sucrose

How well did you know this?

Not at all

Perfectly

Amylose has α1 → 6 branching about every \_\_\_\_\_\_\_\_ residues.
  1 to 10 
  8 to 12 
  10 to 30 
  24 to 30 
  No branching

No branching

How well did you know this?

Not at all

Perfectly

Besides C, H, and O, chitin has which other element in its structure?

  F 
  Cl 
  P 
  S 
  N

How well did you know this?

Not at all

Perfectly

Some carbohydrates form a(n)___________ structure, which resembles a structure in proteins.

A) α form

B) β-turn

C) βeta-sheet

D) D-configuration

E) α-helix

How well did you know this?

Not at all

Perfectly

The equilibrium between _________ structures is called mutarotation.

A) Anomer and epimer

B) α and β

C) L and D

D) Helix and beta sheet

E) None of the above

How well did you know this?

Not at all

Perfectly

Carbohydrates are not used in the following function.

  Structure 
  Energy storage 
  RNA sugar 
  Metabolic intermediate 
  All of the above are functions.

All are functions

How well did you know this?

Not at all

Perfectly

Which word is Greek for sugar?

  Sugar 
  Carbohydrate
  Saccharide 
  Sucrose 
  Starch

Saccharide

How well did you know this?

Not at all

Perfectly

Table sugar dissolves easily in water. Given its structure, explain why this is.

Sucrose contains -OH groups which can form hydrogen bonds with water. These non-covalent interactions permit solubility by permitting carbohydrates to interact with water and become an aqueous solution.

How well did you know this?

Not at all

Perfectly

A hiker is lost in the wilderness and without food. He runs across several beetles with hard chitin exoskeletons. Would he get nutrition in the form of glucose from eating these beetles? Explain.

The human enzyme cannot break down the bond between the glucose residues in chitin. The bond is a β1 →4, but human enzymes only act upon α 1 →4. So, no he should not eat the beetles as food.

How well did you know this?

Not at all

Perfectly

How are oligosaccharides and polysaccharides similar in their structure? How are they different?

An oligosaccharide is a polymer of 2 to 20 monosaccharides joined together. A polysaccharide is more than 20 monosaccharides joined together. They are typically linked together by the same
1 → 4 linkages practically, and there are usually thousands of monosaccharides in a polysaccharide. In addition, polysaccharides can have branches in the structure, which permits them to form large complexes. In contrast, most oligosaccharides do not have branching.

How well did you know this?

Not at all

Perfectly

Glycerol contains how many alcohol functional groups?

1
2
3
4

How well did you know this?

Not at all

Perfectly

Which of the following are derived from or made from fatty acids?
  Cholesterol 
  Carotenoids 
  Phosphoglycerides 
  Both A and B 
  Both A and C

Phosphoglycerides

How well did you know this?

Not at all

Perfectly

``` Triacylglycerols are made from a ________ and ________. glycerol; cholesterol glycerol; three fatty acids ceramide; three fatty acids ceramide; three cholesterols carotenoid; two cholesterols ```

glycerol and 3 fatty acids

Which of the following refers to carboxylic acids that are structural components of lipids? ``` Amino acids Anomers Fatty acids Gluconic acid Sphingolipids ```

FAtty acids

``` A particular lipid is a solid at room temperature, so it is called a(n) ________. Carotenoid Oil Sphingolipid Fat Membrane ```

fat

``` ________ are a class of membrane proteins that are firmly associated with the membrane bilayer. Peripheral protein Integral protein Channel protein Transport protein Inner transmembrane protein ```

Integral

``` Isoprene units are used to make _____________. A. Fatty acids B. Carotenoid molecules C. Sphingolipids D. Both B and C E. All of the above ```

carotenoid molecules

Which notation is for a fatty acid with one double bond? A) 18:1(Δ12) B) 1:18(Δ12,15) C) 1:12(Δ12) D) 2:18(Δ12,15) E) 12:1(Δ7,9)

Which notation indicates a 20-carbon omega-3 fatty acid that contains no other double bonds? A) 20:1 (Δ11) B) 20:1(Δ18) C) 20:1(Δ17) D) 20:1(Δ3) E) 20:3(Δ3omega)

``` Which of the following is used as the backbone molecule in the formation of storage fats? Glycogen Glycerol Sphingolipid Glucose Phosphoglycerol ```

Glycerol

``` Which types of membrane lipids determine the blood type of humans? Triacylglycerols Phosphoglycerides Cholesterol Fatty acids Sphingolipids ```

Sphingolipids

``` Sphingolipids are found in high concentrations in the membranes of __________. organelles myelin sheaths all cells heart cells Vitamin K lipids ```

myelin sheaths

``` In a sphingolipid, the fatty acids are attached at carbon-2 by this type of linkage? Amide linkage An ether linkage An alcohol linkage A peptide linkage Alkyl linkage ```

Amide

``` Membrane proteins: Are sometimes peripheral Are sometimes integral Assist in the transport of molecules Can get nutrients in and the waste molecule out of the cell All are correct ```

all are correct

Peripheral membrane proteins Go all the way through the membrane and are firmly attached to the membrane Are firmly attached to the membrane Are lipids that can be either on the top of the cell or bottom of the cell Are associated with the inside or outside surface of the membrane None of the above

are associated with the inside or outside surface of the membrane

Which statement best describes a general feature of membranes? Individual lipid molecules are free to move in the membrane The interior of the lipid bilayer is very polar The membrane breaks easily The polar heads face inward The membrane is rigid

Individual lipid molecules are free to move in the membrane

``` Vitamin K is important for _________. Blood coagulation Blood type Myelin sheaths Membrane dynamics Dye formation ```

Blood coagulation

``` What molecule is not found in membrane bilayers? Phosphoglycerides Sphingolipid Cholesterol Integral proteins None of these ```

none of these

``` What molecule that protects against UV rays is found both in bacteria and in the eyes? Sphingolipids Carotenoid Triacylglycerol Cholesterol Water ```

carotenoid

``` What molecule has four fused rings in its structure? Sphingolipid Carotenoid Triacylglycerol Cholesterol Water ```

Cholesterol

In triacylglycerols, fatty acids are attached to glycerol via a/an______ linkage. - O-CO- - NH- - O-NH- - COO- - C=C-

-O-CO

``` A lipid is __________. A fat A molecule that dissolves in a non-polar solvent Is made from isoprene units An oil made up of carbon and oxygens Is water soluble ```

A molecule that dissolves in a non-polar solvent

A particular fatty acid molecule has two bends, or kinks, in its structure. What is the cause of the bending or kinking?

Double bonds cause the fatty acids to bend or kink about in solution. These double bonds reduce the packing structure of fatty acids making them more liquid-like.

Where in the body are membranes found?

In the cell. The cell, itself, and the organelles have membranes.

One type of lipid is prominent in myelin sheaths. What is this the lipid and what is unique about its structure?

Sphingomyelins are a subtype of sphingolipids that occur in all membrane bilayers but are especially prominent in the myelin sheath of some neurons. This subclass of sphingolipids typically has a polar head group with a neutral charge. Another unique part of the structure is the ceramide linking of the fatty acid on carbon-2.

What molecules are storage fats? How do these molecules differ from those that make up cellular membranes?

Triacylglycerols are nonpolar molecules that can be stored as energy. They are a non-polar molecule (hydrophobic), so they do not interact with water. Phosphoglycerides, on the other hand, have both polar and nonpolar regions that permit them to interact with both polar and nonpolar environments making them perfect for membrane bilayers.

Which types of molecules are most likely to be present in membranes?

Phosphoglycerides, sphingolipids, cholesterol, and proteins are all found in the membrane. These molecules are all loosely associated with each other as described by the fluid mosaic model of the cellular membrane. They form a membrane bilayer.

``` In RNA, guanine always pairs with ________. Thymine Guanine Cytosine Uracil Both A and B ```

cytosine

``` DNA is built from which of the following? Nucleosides Genes Purines Nucleotide Codons ```

nucleotide

``` The structure of tRNA is held together, primarily, by which of the following? Hydrogen bonds London forces Covalent bonds Ion-dipole bonds Hydrogen covalent bonds ```

Hydrogen bonds

Which of the following pentose sugars is a constituent of B-DNA? ``` Xylose Ribitol Ribose Arabinose 2-deoxyribose ```

2 deoxyribose

``` Pyrimidines have ________ ring(s), (each) containing ______ nitrogen(s), whereas purines have ________ ring(s), (each) containing ______ nitrogen(s). 1; 1; 1; 1 1; 2; 2; 2 2; 2; 1; 2 2; 1; 1; 2 2; 2; 1; 1 ```

1; 2, 2; 2

``` Which of the following nucleic acids is responsible for using the encoded genetic information to produce proteins found in living organisms? Peptide nucleic acid Ribonucleic acid Ribitol nucleic acid Deoxyribonucleic acid Glycerol nucleic acid ```

ribonucleic acid

``` Identify the complementary bases from the following. Adenine-Cytosine Adenine- Thymine Guanine-Thymine Guanine-Adenine Cytosine-Uracil ```

adenine-thiamine

``` How many hydrogen bonds are made between A and its complementary nucleotide? 1 2 3 4 5 ```

``` The base sequence along one strand of DNA of 5’-GCATGAGCC-3’. What is the sequence of the complementary strand of DNA? 5’-CTAGTCCGC-3’ 3’-CGTACTCGG-5’ 3’-CTAGTCCGC-5’ 3’-CAGTCAGCT-5’ 5’-CTGACTACG-3’ ```

3'- CGTACTCG-5'

``` Which of the following types of RNA functions as part of the complex that makes proteins? mRNA gRNA rRNA snRNA tRNA ```

rRNA

``` The ________ is the set of three sequential nucleotides that encodes for a particular amino acid. Anticodon Allele Gene Codon Chromosome ```

codon

``` A type of DNA that has a right-handed helix is the __________. A-form X-Form C-form L-form Z-form ```

A- form

``` Which of the following is a second messenger in cells? FAD cAMP AMP dATP UTP ```

cAMP

``` rRNA makes up about _________ percent of ribosomes.65 65 35 20 90 0 ```

``` The conclusion that G and C are present in DNA in equimolar amounts is credited to ______. James Watson Francis Crick Erwin Chargaff Both A and B None of the above ```

Erwin Chargaff

``` The order of nucleotides in DNA is written __________. to C C to N 3’ to 5’ 5’ to 3’ Both C and D ```

5' to 3'

In the Watson-Crick model for the double helix, which statement is NOT true? The two strands run anti-parallel to one another The base-pairing occurs on the inside of the double helix. The double helix (B form) is right-handed. Two equally sized grooves that run up the sides of the helix. The two strands have complementary sequences.

Two equally sized grooves that run up the sides of the helix

``` Besides ATP, which other nucleotide is part of energy storage in cells? ATP UTP TTP CTP GTP ```

GTP

``` A major component of RNA but not DNA is: AMP GMP UMP CMP TMP ```

UMP

One strand of a double-helical DNA has the sequence (5’)GCGCAATATTCTCAAAATAT(3’). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry.

A. (3’)CGCGTTATAAGAGTTTTATA(5’) B. The nucleotide sequences of complementary strands are such that, whenever an A occurs in one strand, there is a T in the other strand with which it can form a hydrogen-bonded base pair. Whenever a C occurs in one strand, a G occurs in the other. A is the base that is complementary to T, and C is the base complementary to G.

Briefly describe how noncovalent interactions contribute to the three-dimensional shapes and structures of RNA molecules.

Hydrogen bonding in regions of complementarity within an RNA chain can result in the formation of a structure. If no complementary regions exist, then an unstructured area will exist within the RNA.

In one sentence, identify the most obvious similarity between the A-form of DNA and the B-form of DNA.

Both A and B form a right-handed helix.

In nucleic acid chemistry, compounds that contain an organic nitrogen-containing base and a sugar are called ____A_____. Two pyrimidine found in DNA in are _____B____ and ____B____. A pyrimidine found in all DNA but not in RNA is ____C_____. In DNA, the pair ____D_____ is held together by two hydrogen bonds. In RNA, the pentose ______E______ serves as the monosaccharides.

A) Nucleosides B) Cytosine and Thymine C) Thymine D) A-T E) Ribose

The monomers of DNA nucleic acids, called nucleotides, consist of three parts. What are those three parts? (Give three)

phosphoric acid, deoxyribose (a pentose sugar), and an organic base.

True or False: The ΔG value for a particular reaction is -78kJ/mol. This value indicates the reaction is NOT spontaneous.

False

True or false: A biochemical metabolic pathway is a single reaction that converts starting material into products.

False

True or false: Two ATP molecules are used in the energy-investing stage of glycolysis.

True

True or False: The citric acid cycle occurs in the absence of oxygen.

False

True or false: The β-oxidation pathway degrades both even-numbered and odd-numbered fatty acids.

True

``` In converting glucose to pyruvate, how many ATP or NADH are produced (or required) in the 1,3-bisphosphoglycerate to 3-phosphoglycerate step in glycolysis? 2 ATP produced 1 ATP required 1 NADH produced 2 NADH and 1 ATP produced None of the above ```

2 ATP produced

``` In converting glucose to pyruvate, how many ATP or NADH are produced (or required) in the phosphoenolpyruvate to pyruvate step in glycolysis? 1 ATP required 1 ATP produced 2 ATP produced 2 ATP required None of the above ```

2 ATP produced

``` What is the primary reactant of glycolysis? Glucose Glucose-6-phosphate Fructose Fructose-6-phosphate Hexokinase ```

glucose

``` In glycolysis, when glucose enters a cell, it is immediately phosphorylated to form glucose-6-phosphate. The phosphate donor in this reaction is ATP, and the enzyme is ________. Hexokinase Aldolase CoA Phosphohexose isomerase None of the above ```

Hexokinase

``` In the last reaction of glycolysis, ATP is formed by the direct transfer of a phosphate group from a metabolite to ADP. This process is referred to as: Substrate-level phosphorylation Protein phosphorylation Lipid phosphorylation Isomerization Photo-protein dephosphorylation ```

substrate level phosphorylation

``` Under anaerobic conditions, to which compound is pyruvate converted? Ethanol DHAP Hexokinase GAP None of the above ```

ethanol

``` The reactions of glycolysis take place in/on the ___________. Mitochondria Cytosol Lysozyme Ribosome Nucleus ```

cytosol

``` How is ATP used in the initial steps of glycolysis? Lipid phosphorylation reagent Isomerization reaction Source for phosphorylation Protein production None of the above ```

source for phosphorylation

Which of the following is a cyclic pathway? A. CAC B. PDH C. Glycolysis D. Oxidative phosphorylation E. β-oxidation

CAC

``` How many ATP molecules does NADH yield after oxidative phosphorylation? 1.5 2 2.5 3 3.5 ```

2.5

``` Besides NADH and FADH2, what energy molecule is produced directly in the citric acid cycle? ATP GTP CTP TTP None of the above ```

GTP

``` Pyruvate conversion to acetyl-CoA production occurs in the ________. Lysosomes Vacuoles Nucleus Mitochondria None of the above ```

mitochondria

Cellular respiration is the process of cells taking in ______ and producing ______ to generate energy. A. Glucose; NADH B. FAD; FADH2 C. CO2; ATP D. NAD+; NADH E. O2; CO2

``` The complete degradation of glucose via cellular respiration occurs in ______ phases. 1 2 3 alternate reversible ```

``` The PDH complex has three enzymes, which are referred to as: P, D, and H E1, E2, and E3 Enzyme A, Enzyme B, and Enzyme C Enzyme a, Enzyme b, and Enzyme c None of the above ```

E1, E2, E3

Of the following, which coenzyme(s) is (are) necessary for β-oxidation? A. O2 B. FAD C. GTP D. Both A and B E. None of the above

The sequential process for oxidizing fatty acids to acetyl-CoA is often called: A. β-degradation B. α-degradation C. Spiral D. α-spiral E. β-spiral

At the end of the Preparatory Phase of glycolysis, there are two products. A) What are the two products? B) What happens to each product?

In step 5 of glycolysis, glucose (six-carbon) is converted to GAP and DHAP (both 3-carbons). GAP goes on in the glycolysis pathway. The other, DHAP, cannot go on through glycolysis directly; it is converted to GAP by triose phosphate isomerase.

Glucose contains ___(A)_____ carbon atoms. The oxidation of a glucose molecule utilizes ______(B)______ ATP. Later, the ____(C)_____ three-carbon products of glycolysis produce ____(D)______ ATP by direct phosphorylation, which gives a net yield of two ATP. In addition, ____(E)_____ NADH are produced in glycolysis.

A) six B) two C) two D)four E) two

he complete oxidative catabolism of glucose to form CO2 and H2O occurs in three phases. Describe each of the three phases giving the important pathway in each phase and the energy molecules produced in each.

First phase: Glucose metabolism begins with glycolysis which degrades the molecule into two molecules of pyruvate and also produces 2 ATP and 2 NADH molecules. The pyruvate is converted to acetyl-CoA. Second Phase: the acetyl-CoA groups are shuttled through the citric acid cycle to generate GTP, NADH, FADH2 molecules along with the release of CO2. Third Phase: the NADH and FADH2 coenzymes are themselves oxidized in the mitochondria to yield ATP by a process called oxidative phosphorylation.

True or False: The majority of reactions of the urea cycle occur on the ribosome.

False

True or False: FADH2 yields 2.5 ATP molecules after donating electrons and hydrogen atoms to the electron transfer chain (ETC).

False

True or False: ATP is invested in the urea cycle.

True

True or False: There are six complexes associated with the ETC.

False

True or False: In the production of ATP via ATP synthase, the H+ ions move from the mitochondrial matrix to the intermembrane space.

False

``` The urea cycle involves _________ reactions (only those in the cyclic portion of the process). 4 5 6 8 10 ```

``` Which amino acids are involved in the urea cycle? A. Ornithine B. Aspartate C. Threonine D. Both A and B E. Both A and C ```

Fumarate reenters the mitochondrion as which of the following molecules? ``` Malate Ornithine Citrulline Fumarase Ammonia ```

malate

``` Urea is useful for excreting nitrogen from cells due to its: A. Ability to form London forces B. High density of nitrogen atoms C. Large size D. Low melting point E. Both B and C ```

``` Which component of the urea cycle is also a member of the CAC? Fumarate Malate Acetyl-CoA Citrate None of the above ```

Fumarate

Oxidative deamination of an amino acid results in a carbon skeleton and the formation of __________. A. N2 B. NH4+ C. NO2 D. NH2 E. NH3

FADH2 donates electrons and H+ to complex ______. ``` I II III IV V ```

III

Which of the ETC complexes does NOT pump H+ ions? ``` Complex I Complex II Complex III Complex IV Both A and B ```

complex II

``` What protein shuttles electrons from Complex III to Complex IV? NADH dehydrogenase Cytochrome C Fumarase Cytochrome B None of the above ```

cytochrome C

``` What molecule transfers electrons and H+ ions from complexes I and II and transfers them to complex III ? NADH FAD Cytochrome C Cytochrome B CoQ ```

CoQ

In what portion of the mitochondrion does the CAC take place? ``` Matrix Intermembrane space Inner membrane Outer membrane Both B and C ```

matrix

At which complex does the following reaction take place? O2 + 4e- + 4H+ → 2H2O ``` Complex I Complex II Complex III Complex IV Both A and B ```

Complex IV

During the electron transport chain, protons are pumped from _________ in the mitochondria. From the intermembrane space to the cytosol From the intermembrane space to the matrix From the matrix to the intermembrane space From outside of the cell to the cytosol From outside of the cell to the matrix

from matrix to intermembrane space

Energy released _________________ is utilized for the synthesis of ATP. As protons flow through ATP synthase and back into the mitochondrial matrix In the digestion of proteins In the degradation of carbohydrates In the formation of ATP None of the above

as protons flow through ATP synthase and back into mitochondrial matrix

At which part of ATP synthase is ATP produced? A. FO B. F1 C. F2 D. Stator E. Both A and C

``` An individual with the MERRF disease, tend to have symptoms of _________. Blood pressure issues Headaches Degenerated nerve cells Red eyes None of the above ```

Degenerated nerve cells

``` In mitochondria, the complex that produces ATP is located in the _______. You Answered A. Intermembrane space B. Outer membrane C. Inner membrane D. Both A and B E. Both B and C ```

_______ causes ATP to be produced. A. GTP B. Rotation of ATP synthase C. Heat applied to ATP synthase D. H2O in ATP synthase E. None of the above

Which of the following is not a part of ATP synthase? A. FO B. F1 C. F2 D. Axle E. Stator

ADP and Pi; ATP; GTP; reductive; citric acid cycle; electron transport chain; three; eight; ten Oxidative phosphorylation occurs in ___(A)_____ phases using NADH and FADH2 generated from the ___(B)_____. Oxidative phosphorylation is the synthesis of ____(C)______ from ____(D)_______, using energy generated by the _____(E)______ reactions.

A) three B) citric acid cycle C) ATP D) ADP and Pi E) electron transport chain

According to the chemiosmotic theory, how is the ETC connected to ATP production? Explain in at least four complete sentences.

The chemical reactions of the ETC provide energy to pump H+ ions from the mitochondrial matrix into the intermembrane space. The reactions also provide electrons and H+ to convert oxygen into water. The net result is that the H+ gradients permit a flow H+ to rotation ATP synthase, producing ATP.

Consider the importance of the mitochondria in energy production. A. What structural features of mitochondria support ATP formation? And B. Where are the complexes of the ETC located in Mitochondria? Explain in at least four complete sentences.

This organelle is the central hub of energy production in the cell and has a complicated structure, including two membranes. The mitochondrion has an outer membrane and an inner membrane. The outer membrane is a bilayer with porin proteins that permit ions and molecules to cross into the intermembrane space. The intermembrane space is the solution between the outer and inner membranes. The inner membrane is a highly selective bilayer permitting only select ions and molecules to cross. The selectivity is crucial for maintaining specific concentrations of H+, ATP, and other species in the mitochondrial matrix. The inner membrane also contains the electron transport chain's protein complexes, which accepts the electrons from the coenzymes. The matrix is the innermost space of mitochondrion, where the citric acid cycle occurs along portions of fatty acid oxidation and the urea cycle. Once the NADH and FADH2 are produced by the citric acid cycle, they are in proximity to the electron transport chain, so that donation of electrons and hydrogen ions is efficient.

True or False: According to the Module, a compound with a molecular mass of 12,000 g/mol is considered a macromolecule.

True

True or False: Biomolecules can have only one functional group.

False

True or False: In a eukaryotic cell, the organelles called ribosomes serve the purpose of digesting macromolecules.

False

True or False: Carbon dioxide has a linear molecular shape AND has a bond angle of 180o.

True

Of the following, ____________ is not a property of carbon. ``` covalent bonding forming cyclic structures forming multiple bonds forming five bonds bonding in long chains ```

forming five bonds

``` Which of the following is an element not typically found in living organisms? Se S P F Na ```

``` _____________ is a functional group found in carbohydrates. Esters Thiols Carboxylic acids Alcohols Amines ```

alcohol

``` A ___________ is a chemical formula that shows how the atoms of a molecule are bonded to one another. Structural formula Line bond formula Empirical formula Ionic formula Condensed formula ```

structural formula

``` In biomolecular structure, if two macromolecules interact it is called a _______. Monomer Dimer Macromolecular structure Supramolecular complex Quasimer complex ```

supramolecular complex

``` An organic compound with this structure, C–OH, contains a ________ functional group. Alkane Alkene Alkyne Alcohol Both b and d ```

alcohol

``` What element has been called the “super glue” of the chemical world? Ca C H O N ```

Carbon

What energy molecule is produced via respiration? ``` ATP Creatine DNA RNA mitochondria ```

ATP

What would be the approximate size of a human cell? a. 12 μm b. 1 nm c. 15 nm d. 0.2 inch e. 15 cm

``` For propane, there are________ carbon and ________hydrogen atoms. 5, 12 4, 10 3, 6 3, 5 None of the above ```

3.6

``` For an organic compound, which structure is the most efficient to draw? Condensed Kekule’ Line bond Structural None of these ```

Line bond

``` When writing an organic functional group, scientists often write an “R” as part of the structure. What does the R indicate? A string of carbon atoms Radon Routine carbon atom Rest of the molecule None of the above ```

Rest of the molecule

According to the module, the study of NON-carbon compounds is referred to as____. ``` Organic chemistry Inorganic chemistry Biochemistry Environmental chemistry None of the above. ```

inorganic chemistry

``` The ___________ functional group was NOT discussed in this module. Alcohol Amine Aromatic Thiol All of these were discussed. ```

all were discussed

``` Which number would be closest to the approximate number of ribosomes in an E. coli cell? A. 1 B. 25 C. 250 D. 25,000 E. Both c and d ```

``` Which of the following would most likely have a cell wall? Marigold flower cells Deer cells Heart cells Human red blood cells All of the above ```

marigold flower cells

Eukaryotes have molecules that provide a protective structure. This network, which is found in all eukaryotes, is called the _____________. ``` Cell wall Cytoplasm Cytosol Cytoskeleton Both Cell wall and Cytoskeleton ```

Cytoskeleton

``` What is the molecule responsible for gout? Luciferin Uric acid Acetic acid Glucose Glycine ```

uric acid

``` About how many different elements are found in living organisms? 9 30 50 68 92 ```

All cells share a foundational property at the cellular level. Give a brief explanation of this foundational similarity.

The fundamental similarity is that each cell type has a plasma membrane that separates life from non-life. The plasma membrane acts as a barrier to most molecules but does have proteins that permit select molecules to cross via proteins (transporters). The plasma membrane permits the cell to have a different composition of molecules inside the cell than out and defines a space for life to occur.

According to the Module, are smaller elements or large elements favored in biological molecules? Explain which one (smaller or larger) are preferred and give at least two examples of elements (smaller or larger) common in the biomolecules.

Smaller elements are preferred. These elements with smaller atomic shells are favored because they can form stable covalent bonds. Strong bonds form by significant overlap of atoms, such as carbon and hydrogen permitting them to share electrons. The bond that forms requires a substantial amount of energy to break, which allows the bonds to withstand insults, such as mechanical and thermal stresses. This bond strength is good news for living organisms. Stable bonds allow cells to form, hair to grow, and skin to protect against abrasion. These elements are common: H, C, O, N, P, S, and Cl. (Se is borderline). Larger elements tend to form ionic compounds–not covalent.

What element is the basis for life? Describe at least two properties of this element that permit it to serve the basis for life.

1. Carbon can form strong covalent bonds with a variety of different elements. 2. Besides, carbon can form double and triple bonds with other carbon atoms and other elements (N and o). 3. Carbon can form long chains by forming numerous carbon-carbon bonds; we call these large molecules polymer. 4. Lastly, carbon can form cyclic structures, which are also called ring compounds.

What the definition of inorganic chemistry? How does it differ from organic chemistry?

Inorganic chemistry is the study of all other elements, but carbon. Organic chemistry is the study of carbon-based compounds both in living and non-living organisms. There is no need to have separate sub-disciples for organic and inorganic chemistry, but for historical and organizational reasons, the difference exists.

Biochemists study the communication within and among organisms. According to the module, what are two other aspects of living organisms that biochemists study?

In the module, biochemists also study the structure and function of biomolecules and the chemical reactions of organisms.

The amino acids serine and threonine both contain sulfur atoms.

False

The side chain of leucine is bonded to the backbone nitrogen atom.

False

The name of the molecule that binds to an enzyme is called the ligand.

False

An inhibitor that binds at the active site is a noncompetitive inhibitor.

False

Which amino acids differ by only one atom? ``` Ser and Cys Ser and Thr Leu and Ile Ala and Ser Asp and Asn ```

Ser and Cys

``` The formation of a peptide bond between two amino acids is an example of a(n) _____ reaction. Cleavage Condensation Group transfer Isomerization Double-bond breaking ```

Condensation

The peptide Ala-Glu-Gly-Ala has ______ . ``` A disulfide bond Five peptide bonds Four peptide bonds Three peptide bonds No C-terminal ```

Three peptide bonds

Formally, when there are 99 or fewer amino acids are covalently linked together that is called a _________. ``` Polypeptide Oligopeptide Peptide Protein Polyprotein ```

polypeptide

What unit is used by biochemists to indicate the mass of a protein? ``` kDa kBa Mol/g g/mol kg ```

kDa

All of the 20 standard amino acids contain an R-group that is attached to the: ``` A) 𝛼 carbon B) Carboxyl group C) Amino group D) 𝛽 carbon E) None of the above ```

Which of the following correctly matches the amino acid with its one letter abbreviation? ``` Isoleucine, S Lysine, K Phenylalanine, P Glutamic acid, G Arginine, A ```

Lysine, K

The order of amino acids in a protein is written _________. 3’ to 5’ 5’ to 3’ N to C-terminus C to N-terminus Smallest to largest amino acid by weight

N to C- terminus

``` In one turn of a helix, there approximate _________ amino acids. 2.3 3.6 4.2 5.4 None of the above ```

3.6

In an alpha helix, the R groups on the amino acid residues: Alternate between the inside and outside of the helix Cause only left-handed helices to form Generate the hydrogen bonds that form the helix Stack within the interior of the helix Are found on the outside of the helix spiral

are found on the outside of the helix spiral

Motifs are classified primarily by their: Amino acid sequence Evolutionary relationships Content and arrangement of the secondary structure Content and arrangement of the tertiary structure Subunit content and arrangement

content and arrangement of the secondary structure

A single folded polypeptide has a globular shape, which describes its ________ structure. ``` You Answered Secondary Tertiary Quaternary Quasi Motif ```

tertiary

``` How many classes of enzymes are recognized by the IUBMB? 5 6 7 10 25 ```

``` An enzyme requires Cr+3 for catalysis. Under conditions of chromium deficiency, when the enzyme lacks chromium, this enzyme would be referred to as a(n): Holoenzyme Apoenzyme Active enzyme Inhibitor Competitive inhibitor ```

apoenzyme

When a substrate has just started its conversion to a new molecule, it is said to be in the ________. ``` Stable mode Unstable mode Transition state Conversion State Conversion Mode ```

transition state

Which of the following would change the rate of an enzyme-catalyzed reaction? amino acids, concentration, and temperature pH, concentration, and temperature pH, polarity, and concentration polarity, concentration, and temperature pH, polarity, and temperature

pH, concentration and temperature

The concept of induced fit refers to the fact that: When a substrate binds to an enzyme, the enzyme induces loss of water Enzyme specificity is induced in the enzyme-substrate The enzyme-substrate binding increases the temperature Substrate binding induces a conformation change in the enzyme The substrate bends and twists before it binds to the enzyme

substrate binding induces a conformation change in the enzyme

The ES stands for: ``` Enzyme-substrate Energy-substance Enzyme-specificity Energy-specificity None of the above ```

Enzyme substrate

``` Any molecule or ion that is necessary for an enzyme’s function is called a: Cofactor Coreactant Coproduct Bienzyme Both B and C ```

cofactor

Staphylokinase is said to be a dimer. A) What is a dimer? B) Structurally, a dimer describes what level of protein organization?

A) This enzyme has two independent polypeptide chains interacting non-covalently. In this case, they are identical chains. B) It is describing the quaternary structure, which has two or more independent polypeptide chains that associate with one another to form a quaternary structure.

There are collections of protein structure that fit between true secondary and true tertiary structure. What is the name of the collections of protein structure? Explain this type of structure.

Motifs occupy a position between secondary and tertiary. Motifs are particularly stable arrangements of secondary structure, including the connections between them. Motifs are found in a variety of proteins from across all organisms.

What is the lowest level of protein structure? And B) How do scientists communicate information about this level?

The primary level is the order of amino acids covalently bonded together, including disulfide bonds, in a polypeptide chain. The primary sequence is written, for proteins, from N to C terminal using the one-letter or three-letter abbreviations.

Define the term “active site.”

The active site is the spot on the enzyme where catalysis takes place. This area is often small when compared to the overall size of the protein. In fact, about 10 amino acids make up the active site.

The pH of a solution of 2.5 x 10-5 M NaOH is: A. 9.4 B. 2.5 x 10-5 C. 9.5 D. 9.0 E. 9.12

Water is a unique molecule. Which of the following contributes to water’s unique place in the chemical world? The geometry of the molecule The polarity of the O-H bonds The ability of water molecules to hydrogen bond The bond angle of water All of the answers are correct

All the answers are correct

What factor contributes to the bent shape of a water molecule? The dipole arrows in a water molecule The unshared electron pairs on the oxygen atom The electronegativity difference between hydrogen and oxygen The unequal electron sharing between hydrogen and oxygen None of the answers are correct

The unshared electron pairs on the oxygen atom

The H+ concentration of a solution is 5.6 x 10-5 What is the pH? - 4.25 4. 25 5. 65 - 9.75 9. 75

4.25

If the Ka of an acid is 2.67 x 10-5, what is the pKa? 7. 45 12. 25 5. 26 2. 67 4. 57

4.57

List the acids in INCREASING order of strength (weakest to strongest): Nitrous acid (Ka = 4.0 x 10-4); acetic acid (Ka = 1.7 x 10-5); phosphoric acid (Ka = 7.3 x 10-3) Nitrous acid, acetic acid, phosphoric acid Acetic acid, nitrous acid, phosphoric acid Phosphoric acid, nitrous acid, acetic acid Acetic acid, phosphoric acid, nitrous acid None of the above

acetic acid, nitrous acid, phosphoric acid

Elemental bromine (Br2) is a liquid at room temperature. What is the dominant attractive force that exists between Br2 molecules in the liquid? ``` Halogen forces Dipole-dipole forces Hydrogen bonds Covalent bonds London forces ```

London forces

Which one of the following molecules can form a hydrogen bond? A. HBr B. HCl C. NH3 D. CH4 E. H2

A hydrogen bond can form between a hydrogen atom bonded to nitrogen, N–H, and ________. ``` C O Cl P Br ```

Oxygen

In a bond between P and Cl, there exists a difference in electronegativity resulting in partial positive and partial negative charges. If a dipole arrow were added to this structure, which way would the arrow point? M2 Exam 11b.png The arrow points from Br toward N The arrow points from N toward Br Two arrows; one pointed in each direction There would not be a dipole arrow in this case. None of the above

arrow points between N and Br

The following reaction occurs in glues purchased from hardware stores. Customers use this product to glue plastic together. Epoxy (l) + hardener (l) ⟶ Glue (s) + heat given off What is the sign (+ or -) of the change in ΔG and ΔH? A) ΔG is (+) and ΔH is (-) B) ΔG is (-) and ΔH is (-) C) ΔG is (-) and ΔH is (+) D) ΔG is (+) and ΔH is (+) E) None of the above

Which of the following is the free-energy change of a reaction? A) G B) ΔS C) ΔH D) ΔG E) All of the above

Which of the following is the change in entropy of a reaction? ``` A) ΔG B) ΔE C) ΔH D) ΔF E) None of the above ```

Which buffer system is used by the blood to maintain pH balance? ``` Vinegar buffer system Acetic acid buffer system Bicarbonate buffer system Water buffers system Formic acid buffer system ```

Bicarbonate buffer system

``` A buffer can neutralize only a certain amount of acid and base. We say that this is its: Buffer limit Buffer range Buffer maintenance Buffer capability Buffer capacity ```

buffer capacity

``` Is a pH of 8.36 acidic, neutral, or basic? Acidic Neutral Basic Both Acidic and Basic Both Neutral and Basic ```

Basic

The “ion product” is equal to what value? A. 1.0 x 10-14 B. 1.0 x 10-7 C. 2.1 x 10-7 D. 5.6 X 10-13 E. None of the abo

``` n equilibrium constant expressions, the double brackets [ ] indicate: The ion product Acid Base Concentration in molarity The acid dissociation constant, Ka ```

concentration in molarity

A pH = 5.0 indicates a concentration of OH- (in M) of __________. A. 5 B. 10-5 C. 10-9 D. 10-1 E. 101

Which of the following compounds would not be soluble in water? A. NaCl B. OH- C. Glucose D. Wax E. All of the above would be soluble

The oxygen in water has what type of hybridization? A. sp B. sp2 C. sp3 D. sp3d E. All of the above

Three identical molecules dissolve in water. Each molecule contains both a polar portion and nonpolar portion of structure. The three molecules interact in such a way that the nonpolar sections align. This is an example of the _________. ``` Hydrophilic rule Hydrophobic effect Buffering capacity Hydrogen bonding effect All of the above ```

Hydrophobic effect

How does the strength of a covalent bond compare to the strength of London Forces and hydrogen bonds? Briefly comment on these differences.

A typical covalent bond is around 400 kcal, while a London force is less than 1 kcal. So, a covalent bond is at least 400 times the size a London force. The hydrogen bond strength is between 12 and 16 kcal, which makes the covalent bond about 40 times a hydrogen bond. Moreover, hydrogen bonds are the strongest non-covalent force, so this is significant.

t cool temperatures, water vapor turns into liquid water releasing heat in the process. Fill in the missing blanks, below, regarding this process. Please identify your answers by writing “A.” then your answer, “B” then your answer, and so forth. The free-energy change, ΔG, has a _____A______ value (choose “+” or “-“). The enthalpy change, __B___ (fill in symbol), has a ___C_____ value (choose “+” or “-“). The _____D______change, (ΔS), has a ______E_____ value (choose “+” or “-“).

A) “-“ B) ΔH C) “-“ D) entropy E) “-”

A group of molecules forms a clathrate in water. What is a clathrate and why does it form?

The hydrophobic effect helps scientists explain how biological molecules form and interact. For instance, when molecules with both a nonpolar and polar regions dissolve in water, the nonpolar regions pack together. The packing of the nonpolar regions minimizes the interaction with water and the polar region interact with water, which in total is called the hydrophobic effect. The driving force behind this effect is the spontaneous drive of water to bind to itself through hydrogen bonds. To maximize the hydrogen bonds, water orders itself around the hydrophobic portion of the nonpolar regions in a cage structure also called a clathrate. In so doing, water can form bonds with itself and also permit the nonpolar regions to be dissolved.