final prep Flashcards
Which of the following monosaccharides is an aldose? Dihydroxyacetone Glyceraldehyde Glucose Lactose
Both B and C
When two monosaccharides are epimers:
They differ only in the configuration about one carbon atom
One is a furanose, the other a pyranose
One is an aldose, the other a ketose
They can form ring structures
They form O-glycosidic bonds
They differ only in the configuration about one carbon atom
Which pair is anomeric? A) D-ribose and D-galactose B) α-D-allose and β-D-allose C) D-Ribose and L-fructose D) D-glucose and L-glucose E) α-D-idose and β-L-idose
B
When forming the disaccharide maltose from two glucose monosaccharides:
Gas is eliminated
A condensation reaction occurs
An anomeric carbon is formed on carbon-1
An epimer is formed
A polysaccharide is formed
A condensation reaction occurs
Amylose and amylopectin are both polymers of:
A) α-D-glucose B) β-D-glucose C) Galactose D) Idose E) Maltose
A
Which statement about starch and glycogen is false?
A) Both have β-D-glucose monomers
B) Both starch and glycogen are energy storage polysaccharides
C) Both are homopolymers of glucose
D) Glycogen is more extensively branched than starch
E) Both have O-glycosidic linkages
A
Which monosaccharide is not a six-carbon monosaccharide? Idose Gulose Galactose Dihydroxyacetone Allose
Dihydroxyacetone
Which statement about cellulose is true?
Cellulose is found in plants
Cellulose is the primary storage polysaccharide of animal cells
Cellulose is found in DNA
The glucose residues of cellulose contain the same configuration as the glucose residues of amylose
Cellulose is an epimer of chitin
A
The polysaccharide chitin is most chemically similar to: Cellulose Dextrose Glycogen Starch Amylose
Cellulose
Which of the following is the most common monosaccharide on earth? Ribose Cellulose Chitin Sucrose Glucose
Glucose
The “D” in the D-carbohydrates stands for: 3-dimensional Dextrorotatory Derivative Design Double
Dextrorotory
Which compound does not fit the formal definition of a carbohydrate?
A. C6H12O6
B. C9H18O9
C. C3H6O3
D. C8H14O8
E. C5H10O5
D
Table sugar is also known as: Sucrose Dextrose Glucose Galactose Glycogen
Sucrose
Amylose has α1 → 6 branching about every \_\_\_\_\_\_\_\_ residues. 1 to 10 8 to 12 10 to 30 24 to 30 No branching
No branching
Besides C, H, and O, chitin has which other element in its structure?
F Cl P S N
N
Some carbohydrates form a(n)___________ structure, which resembles a structure in proteins.
A) α form
B) β-turn
C) βeta-sheet
D) D-configuration
E) α-helix
E
The equilibrium between _________ structures is called mutarotation.
A) Anomer and epimer
B) α and β
C) L and D
D) Helix and beta sheet
E) None of the above
B
Carbohydrates are not used in the following function.
Structure Energy storage RNA sugar Metabolic intermediate All of the above are functions.
All are functions
Which word is Greek for sugar?
Sugar Carbohydrate Saccharide Sucrose Starch
Saccharide
Table sugar dissolves easily in water. Given its structure, explain why this is.
Sucrose contains -OH groups which can form hydrogen bonds with water. These non-covalent interactions permit solubility by permitting carbohydrates to interact with water and become an aqueous solution.
A hiker is lost in the wilderness and without food. He runs across several beetles with hard chitin exoskeletons. Would he get nutrition in the form of glucose from eating these beetles? Explain.
The human enzyme cannot break down the bond between the glucose residues in chitin. The bond is a β1 →4, but human enzymes only act upon α 1 →4. So, no he should not eat the beetles as food.
How are oligosaccharides and polysaccharides similar in their structure? How are they different?
An oligosaccharide is a polymer of 2 to 20 monosaccharides joined together. A polysaccharide is more than 20 monosaccharides joined together. They are typically linked together by the same
1 → 4 linkages practically, and there are usually thousands of monosaccharides in a polysaccharide. In addition, polysaccharides can have branches in the structure, which permits them to form large complexes. In contrast, most oligosaccharides do not have branching.
Glycerol contains how many alcohol functional groups?
1
2
3
4
3
Which of the following are derived from or made from fatty acids? Cholesterol Carotenoids Phosphoglycerides Both A and B Both A and C
Phosphoglycerides
Triacylglycerols are made from a \_\_\_\_\_\_\_\_ and \_\_\_\_\_\_\_\_. glycerol; cholesterol glycerol; three fatty acids ceramide; three fatty acids ceramide; three cholesterols carotenoid; two cholesterols
glycerol and 3 fatty acids
Which of the following refers to carboxylic acids that are structural components of lipids?
Amino acids Anomers Fatty acids Gluconic acid Sphingolipids
FAtty acids
A particular lipid is a solid at room temperature, so it is called a(n) \_\_\_\_\_\_\_\_. Carotenoid Oil Sphingolipid Fat Membrane
fat
\_\_\_\_\_\_\_\_ are a class of membrane proteins that are firmly associated with the membrane bilayer. Peripheral protein Integral protein Channel protein Transport protein Inner transmembrane protein
Integral
Isoprene units are used to make \_\_\_\_\_\_\_\_\_\_\_\_\_. A. Fatty acids B. Carotenoid molecules C. Sphingolipids D. Both B and C E. All of the above
carotenoid molecules
Which notation is for a fatty acid with one double bond?
A) 18:1(Δ12)
B) 1:18(Δ12,15)
C) 1:12(Δ12)
D) 2:18(Δ12,15)
E) 12:1(Δ7,9)
A
Which notation indicates a 20-carbon omega-3 fatty acid that contains no other double bonds?
A) 20:1 (Δ11)
B) 20:1(Δ18)
C) 20:1(Δ17)
D) 20:1(Δ3)
E) 20:3(Δ3omega)
C
Which of the following is used as the backbone molecule in the formation of storage fats? Glycogen Glycerol Sphingolipid Glucose Phosphoglycerol
Glycerol
Which types of membrane lipids determine the blood type of humans? Triacylglycerols Phosphoglycerides Cholesterol Fatty acids Sphingolipids
Sphingolipids
Sphingolipids are found in high concentrations in the membranes of \_\_\_\_\_\_\_\_\_\_. organelles myelin sheaths all cells heart cells Vitamin K lipids
myelin sheaths
In a sphingolipid, the fatty acids are attached at carbon-2 by this type of linkage? Amide linkage An ether linkage An alcohol linkage A peptide linkage Alkyl linkage
Amide
Membrane proteins: Are sometimes peripheral Are sometimes integral Assist in the transport of molecules Can get nutrients in and the waste molecule out of the cell All are correct
all are correct
Peripheral membrane proteins
Go all the way through the membrane and are firmly attached to the membrane
Are firmly attached to the membrane
Are lipids that can be either on the top of the cell or bottom of the cell
Are associated with the inside or outside surface of the membrane
None of the above
are associated with the inside or outside surface of the membrane
Which statement best describes a general feature of membranes?
Individual lipid molecules are free to move in the membrane
The interior of the lipid bilayer is very polar
The membrane breaks easily
The polar heads face inward
The membrane is rigid
Individual lipid molecules are free to move in the membrane
Vitamin K is important for \_\_\_\_\_\_\_\_\_. Blood coagulation Blood type Myelin sheaths Membrane dynamics Dye formation
Blood coagulation
What molecule is not found in membrane bilayers? Phosphoglycerides Sphingolipid Cholesterol Integral proteins None of these
none of these
What molecule that protects against UV rays is found both in bacteria and in the eyes? Sphingolipids Carotenoid Triacylglycerol Cholesterol Water
carotenoid
What molecule has four fused rings in its structure? Sphingolipid Carotenoid Triacylglycerol Cholesterol Water
Cholesterol
In triacylglycerols, fatty acids are attached to glycerol via a/an______ linkage.
- O-CO-
- NH-
- O-NH-
- COO-
- C=C-
-O-CO
A lipid is \_\_\_\_\_\_\_\_\_\_. A fat A molecule that dissolves in a non-polar solvent Is made from isoprene units An oil made up of carbon and oxygens Is water soluble
A molecule that dissolves in a non-polar solvent
A particular fatty acid molecule has two bends, or kinks, in its structure. What is the cause of the bending or kinking?
Double bonds cause the fatty acids to bend or kink about in solution. These double bonds reduce the packing structure of fatty acids making them more liquid-like.
Where in the body are membranes found?
In the cell. The cell, itself, and the organelles have membranes.
One type of lipid is prominent in myelin sheaths. What is this the lipid and what is unique about its structure?
Sphingomyelins are a subtype of sphingolipids that occur in all membrane bilayers but are especially prominent in the myelin sheath of some neurons. This subclass of sphingolipids typically has a polar head group with a neutral charge. Another unique part of the structure is the ceramide linking of the fatty acid on carbon-2.
What molecules are storage fats? How do these molecules differ from those that make up cellular membranes?
Triacylglycerols are nonpolar molecules that can be stored as energy. They are a non-polar molecule (hydrophobic), so they do not interact with water. Phosphoglycerides, on the other hand, have both polar and nonpolar regions that permit them to interact with both polar and nonpolar environments making them perfect for membrane bilayers.
Which types of molecules are most likely to be present in membranes?
Phosphoglycerides, sphingolipids, cholesterol, and proteins are all found in the membrane. These molecules are all loosely associated with each other as described by the fluid mosaic model of the cellular membrane. They form a membrane bilayer.
In RNA, guanine always pairs with \_\_\_\_\_\_\_\_. Thymine Guanine Cytosine Uracil Both A and B
cytosine
DNA is built from which of the following? Nucleosides Genes Purines Nucleotide Codons
nucleotide
The structure of tRNA is held together, primarily, by which of the following? Hydrogen bonds London forces Covalent bonds Ion-dipole bonds Hydrogen covalent bonds
Hydrogen bonds
Which of the following pentose sugars is a constituent of B-DNA?
Xylose Ribitol Ribose Arabinose 2-deoxyribose
2 deoxyribose
Pyrimidines have \_\_\_\_\_\_\_\_ ring(s), (each) containing \_\_\_\_\_\_ nitrogen(s), whereas purines have \_\_\_\_\_\_\_\_ ring(s), (each) containing \_\_\_\_\_\_ nitrogen(s). 1; 1; 1; 1 1; 2; 2; 2 2; 2; 1; 2 2; 1; 1; 2 2; 2; 1; 1
1; 2, 2; 2
Which of the following nucleic acids is responsible for using the encoded genetic information to produce proteins found in living organisms? Peptide nucleic acid Ribonucleic acid Ribitol nucleic acid Deoxyribonucleic acid Glycerol nucleic acid
ribonucleic acid
Identify the complementary bases from the following. Adenine-Cytosine Adenine- Thymine Guanine-Thymine Guanine-Adenine Cytosine-Uracil
adenine-thiamine
How many hydrogen bonds are made between A and its complementary nucleotide? 1 2 3 4 5
2
The base sequence along one strand of DNA of 5’-GCATGAGCC-3’. What is the sequence of the complementary strand of DNA? 5’-CTAGTCCGC-3’ 3’-CGTACTCGG-5’ 3’-CTAGTCCGC-5’ 3’-CAGTCAGCT-5’ 5’-CTGACTACG-3’
3’- CGTACTCG-5’
Which of the following types of RNA functions as part of the complex that makes proteins? mRNA gRNA rRNA snRNA tRNA
rRNA
The \_\_\_\_\_\_\_\_ is the set of three sequential nucleotides that encodes for a particular amino acid. Anticodon Allele Gene Codon Chromosome
codon
A type of DNA that has a right-handed helix is the \_\_\_\_\_\_\_\_\_\_. A-form X-Form C-form L-form Z-form
A- form
Which of the following is a second messenger in cells? FAD cAMP AMP dATP UTP
cAMP
rRNA makes up about \_\_\_\_\_\_\_\_\_ percent of ribosomes.65 65 35 20 90 0
65
The conclusion that G and C are present in DNA in equimolar amounts is credited to \_\_\_\_\_\_. James Watson Francis Crick Erwin Chargaff Both A and B None of the above
Erwin Chargaff
The order of nucleotides in DNA is written \_\_\_\_\_\_\_\_\_\_. to C C to N 3’ to 5’ 5’ to 3’ Both C and D
5’ to 3’
In the Watson-Crick model for the double helix, which statement is NOT true?
The two strands run anti-parallel to one another
The base-pairing occurs on the inside of the double helix.
The double helix (B form) is right-handed.
Two equally sized grooves that run up the sides of the helix.
The two strands have complementary sequences.
Two equally sized grooves that run up the sides of the helix
Besides ATP, which other nucleotide is part of energy storage in cells? ATP UTP TTP CTP GTP
GTP
A major component of RNA but not DNA is: AMP GMP UMP CMP TMP
UMP
One strand of a double-helical DNA has the sequence (5’)GCGCAATATTCTCAAAATAT(3’).
A) Write the base sequence of the complementary strand.
B) Explain what complementary means in nucleic acid chemistry.
A. (3’)CGCGTTATAAGAGTTTTATA(5’)
B. The nucleotide sequences of complementary strands are such that, whenever an A occurs in one strand, there is a T in the other strand with which it can form a hydrogen-bonded base pair. Whenever a C occurs in one strand, a G occurs in the other. A is the base that is complementary to T, and C is the base complementary to G.
Briefly describe how noncovalent interactions contribute to the three-dimensional shapes and structures of RNA molecules.
Hydrogen bonding in regions of complementarity within an RNA chain can result in the formation of a structure. If no complementary regions exist, then an unstructured area will exist within the RNA.
In one sentence, identify the most obvious similarity between the A-form of DNA and the B-form of DNA.
Both A and B form a right-handed helix.
In nucleic acid chemistry, compounds that contain an organic nitrogen-containing base and a sugar are called ____A_____.
Two pyrimidine found in DNA in are _____B____ and ____B____.
A pyrimidine found in all DNA but not in RNA is ____C_____.
In DNA, the pair ____D_____ is held together by two hydrogen bonds.
In RNA, the pentose ______E______ serves as the monosaccharides.
A) Nucleosides
B) Cytosine and Thymine
C) Thymine
D) A-T
E) Ribose
The monomers of DNA nucleic acids, called nucleotides, consist of three parts. What are those three parts? (Give three)
phosphoric acid, deoxyribose (a pentose sugar), and an organic base.
True or False: The ΔG value for a particular reaction is -78kJ/mol. This value indicates the reaction is NOT spontaneous.
False
True or false: A biochemical metabolic pathway is a single reaction that converts starting material into products.
False
True or false: Two ATP molecules are used in the energy-investing stage of glycolysis.
True
True or False: The citric acid cycle occurs in the absence of oxygen.
False
True or false: The β-oxidation pathway degrades both even-numbered and odd-numbered fatty acids.
True
In converting glucose to pyruvate, how many ATP or NADH are produced (or required) in the 1,3-bisphosphoglycerate to 3-phosphoglycerate step in glycolysis? 2 ATP produced 1 ATP required 1 NADH produced 2 NADH and 1 ATP produced None of the above
2 ATP produced
In converting glucose to pyruvate, how many ATP or NADH are produced (or required) in the phosphoenolpyruvate to pyruvate step in glycolysis? 1 ATP required 1 ATP produced 2 ATP produced 2 ATP required None of the above
2 ATP produced
What is the primary reactant of glycolysis? Glucose Glucose-6-phosphate Fructose Fructose-6-phosphate Hexokinase
glucose
In glycolysis, when glucose enters a cell, it is immediately phosphorylated to form glucose-6-phosphate. The phosphate donor in this reaction is ATP, and the enzyme is \_\_\_\_\_\_\_\_. Hexokinase Aldolase CoA Phosphohexose isomerase None of the above
Hexokinase
In the last reaction of glycolysis, ATP is formed by the direct transfer of a phosphate group from a metabolite to ADP. This process is referred to as: Substrate-level phosphorylation Protein phosphorylation Lipid phosphorylation Isomerization Photo-protein dephosphorylation
substrate level phosphorylation
Under anaerobic conditions, to which compound is pyruvate converted? Ethanol DHAP Hexokinase GAP None of the above
ethanol
The reactions of glycolysis take place in/on the \_\_\_\_\_\_\_\_\_\_\_. Mitochondria Cytosol Lysozyme Ribosome Nucleus
cytosol
How is ATP used in the initial steps of glycolysis? Lipid phosphorylation reagent Isomerization reaction Source for phosphorylation Protein production None of the above
source for phosphorylation
Which of the following is a cyclic pathway?
A. CAC
B. PDH
C. Glycolysis
D. Oxidative phosphorylation
E. β-oxidation
CAC
How many ATP molecules does NADH yield after oxidative phosphorylation? 1.5 2 2.5 3 3.5
2.5
Besides NADH and FADH2, what energy molecule is produced directly in the citric acid cycle? ATP GTP CTP TTP None of the above
GTP
Pyruvate conversion to acetyl-CoA production occurs in the \_\_\_\_\_\_\_\_. Lysosomes Vacuoles Nucleus Mitochondria None of the above
mitochondria
Cellular respiration is the process of cells taking in ______ and producing ______ to generate energy.
A. Glucose; NADH
B. FAD; FADH2
C. CO2; ATP
D. NAD+; NADH
E. O2; CO2
E
The complete degradation of glucose via cellular respiration occurs in \_\_\_\_\_\_ phases. 1 2 3 alternate reversible
3
The PDH complex has three enzymes, which are referred to as: P, D, and H E1, E2, and E3 Enzyme A, Enzyme B, and Enzyme C Enzyme a, Enzyme b, and Enzyme c None of the above
E1, E2, E3
Of the following, which coenzyme(s) is (are) necessary for β-oxidation?
A. O2
B. FAD
C. GTP
D. Both A and B
E. None of the above
B
The sequential process for oxidizing fatty acids to acetyl-CoA is often called:
A. β-degradation
B. α-degradation
C. Spiral
D. α-spiral
E. β-spiral
E
At the end of the Preparatory Phase of glycolysis, there are two products. A) What are the two products? B) What happens to each product?
In step 5 of glycolysis, glucose (six-carbon) is converted to GAP and DHAP (both 3-carbons). GAP goes on in the glycolysis pathway. The other, DHAP, cannot go on through glycolysis directly; it is converted to GAP by triose phosphate isomerase.
Glucose contains ___(A)_____ carbon atoms. The oxidation of a glucose molecule utilizes ______(B)______ ATP. Later, the ____(C)_____ three-carbon products of glycolysis produce ____(D)______ ATP by direct phosphorylation, which gives a net yield of two ATP. In addition, ____(E)_____ NADH are produced in glycolysis.
A) six
B) two
C) two
D)four
E) two
he complete oxidative catabolism of glucose to form CO2 and H2O occurs in three phases. Describe each of the three phases giving the important pathway in each phase and the energy molecules produced in each.
First phase: Glucose metabolism begins with glycolysis which degrades the molecule into two molecules of pyruvate and also produces 2 ATP and 2 NADH molecules. The pyruvate is converted to acetyl-CoA. Second Phase: the acetyl-CoA groups are shuttled through the citric acid cycle to generate GTP, NADH, FADH2 molecules along with the release of CO2. Third Phase: the NADH and FADH2 coenzymes are themselves oxidized in the mitochondria to yield ATP by a process called oxidative phosphorylation.
True or False: The majority of reactions of the urea cycle occur on the ribosome.
False
True or False: FADH2 yields 2.5 ATP molecules after donating electrons and hydrogen atoms to the electron transfer chain (ETC).
False
True or False: ATP is invested in the urea cycle.
True
True or False: There are six complexes associated with the ETC.
False
True or False: In the production of ATP via ATP synthase, the H+ ions move from the mitochondrial matrix to the intermembrane space.
False
The urea cycle involves \_\_\_\_\_\_\_\_\_ reactions (only those in the cyclic portion of the process). 4 5 6 8 10
4`
Which amino acids are involved in the urea cycle? A. Ornithine B. Aspartate C. Threonine D. Both A and B E. Both A and C
D
Fumarate reenters the mitochondrion as which of the following molecules?
Malate Ornithine Citrulline Fumarase Ammonia
malate
Urea is useful for excreting nitrogen from cells due to its: A. Ability to form London forces B. High density of nitrogen atoms C. Large size D. Low melting point E. Both B and C
B
Which component of the urea cycle is also a member of the CAC? Fumarate Malate Acetyl-CoA Citrate None of the above
Fumarate
Oxidative deamination of an amino acid results in a carbon skeleton and the formation of __________.
A. N2
B. NH4+
C. NO2
D. NH2
E. NH3
B
FADH2 donates electrons and H+ to complex ______.
I II III IV V
III
Which of the ETC complexes does NOT pump H+ ions?
Complex I Complex II Complex III Complex IV Both A and B
complex II
What protein shuttles electrons from Complex III to Complex IV? NADH dehydrogenase Cytochrome C Fumarase Cytochrome B None of the above
cytochrome C
What molecule transfers electrons and H+ ions from complexes I and II and transfers them to complex III ? NADH FAD Cytochrome C Cytochrome B CoQ
CoQ
In what portion of the mitochondrion does the CAC take place?
Matrix Intermembrane space Inner membrane Outer membrane Both B and C
matrix
At which complex does the following reaction take place?
O2 + 4e- + 4H+ → 2H2O
Complex I Complex II Complex III Complex IV Both A and B
Complex IV
During the electron transport chain, protons are pumped from _________ in the mitochondria.
From the intermembrane space to the cytosol
From the intermembrane space to the matrix
From the matrix to the intermembrane space
From outside of the cell to the cytosol
From outside of the cell to the matrix
from matrix to intermembrane space
Energy released _________________ is utilized for the synthesis of ATP.
As protons flow through ATP synthase and back into the mitochondrial matrix
In the digestion of proteins
In the degradation of carbohydrates
In the formation of ATP
None of the above
as protons flow through ATP synthase and back into mitochondrial matrix
At which part of ATP synthase is ATP produced?
A. FO
B. F1
C. F2
D. Stator
E. Both A and C
B
An individual with the MERRF disease, tend to have symptoms of \_\_\_\_\_\_\_\_\_. Blood pressure issues Headaches Degenerated nerve cells Red eyes None of the above
Degenerated nerve cells
In mitochondria, the complex that produces ATP is located in the \_\_\_\_\_\_\_. You Answered A. Intermembrane space B. Outer membrane C. Inner membrane D. Both A and B E. Both B and C
C
_______ causes ATP to be produced.
A. GTP
B. Rotation of ATP synthase
C. Heat applied to ATP synthase
D. H2O in ATP synthase
E. None of the above
B
Which of the following is not a part of ATP synthase?
A. FO
B. F1
C. F2
D. Axle
E. Stator
C
ADP and Pi; ATP; GTP; reductive; citric acid cycle; electron transport chain; three; eight; ten
Oxidative phosphorylation occurs in ___(A)_____ phases using NADH and FADH2 generated from the ___(B)_____.
Oxidative phosphorylation is the synthesis of ____(C)______ from ____(D)_______, using energy generated by the _____(E)______ reactions.
A) three
B) citric acid cycle
C) ATP
D) ADP and Pi
E) electron transport chain
According to the chemiosmotic theory, how is the ETC connected to ATP production?
Explain in at least four complete sentences.
The chemical reactions of the ETC provide energy to pump H+ ions from the mitochondrial matrix into the intermembrane space. The reactions also provide electrons and H+ to convert oxygen into water. The net result is that the H+ gradients permit a flow H+ to rotation ATP synthase, producing ATP.
Consider the importance of the mitochondria in energy production.
A. What structural features of mitochondria support ATP formation?
And
B. Where are the complexes of the ETC located in Mitochondria?
Explain in at least four complete sentences.
This organelle is the central hub of energy production in the cell and has a complicated structure, including two membranes. The mitochondrion has an outer membrane and an inner membrane. The outer membrane is a bilayer with porin proteins that permit ions and molecules to cross into the intermembrane space. The intermembrane space is the solution between the outer and inner membranes. The inner membrane is a highly selective bilayer permitting only select ions and molecules to cross. The selectivity is crucial for maintaining specific concentrations of H+, ATP, and other species in the mitochondrial matrix. The inner membrane also contains the electron transport chain’s protein complexes, which accepts the electrons from the coenzymes. The matrix is the innermost space of mitochondrion, where the citric acid cycle occurs along portions of fatty acid oxidation and the urea cycle. Once the NADH and FADH2 are produced by the citric acid cycle, they are in proximity to the electron transport chain, so that donation of electrons and hydrogen ions is efficient.
True or False: According to the Module, a compound with a molecular mass of 12,000 g/mol is considered a macromolecule.
True
True or False: Biomolecules can have only one functional group.
False
True or False: In a eukaryotic cell, the organelles called ribosomes serve the purpose of digesting macromolecules.
False
True or False: Carbon dioxide has a linear molecular shape AND has a bond angle of 180o.
True
Of the following, ____________ is not a property of carbon.
covalent bonding forming cyclic structures forming multiple bonds forming five bonds bonding in long chains
forming five bonds
Which of the following is an element not typically found in living organisms? Se S P F Na
F
\_\_\_\_\_\_\_\_\_\_\_\_\_ is a functional group found in carbohydrates. Esters Thiols Carboxylic acids Alcohols Amines
alcohol
A \_\_\_\_\_\_\_\_\_\_\_ is a chemical formula that shows how the atoms of a molecule are bonded to one another. Structural formula Line bond formula Empirical formula Ionic formula Condensed formula
structural formula
In biomolecular structure, if two macromolecules interact it is called a \_\_\_\_\_\_\_. Monomer Dimer Macromolecular structure Supramolecular complex Quasimer complex
supramolecular complex
An organic compound with this structure, C–OH, contains a \_\_\_\_\_\_\_\_ functional group. Alkane Alkene Alkyne Alcohol Both b and d
alcohol
What element has been called the “super glue” of the chemical world? Ca C H O N
Carbon
What energy molecule is produced via respiration?
ATP Creatine DNA RNA mitochondria
ATP
What would be the approximate size of a human cell?
a. 12 μm
b. 1 nm
c. 15 nm
d. 0.2 inch
e. 15 cm
A
For propane, there are\_\_\_\_\_\_\_\_ carbon and \_\_\_\_\_\_\_\_hydrogen atoms. 5, 12 4, 10 3, 6 3, 5 None of the above
3.6
For an organic compound, which structure is the most efficient to draw? Condensed Kekule’ Line bond Structural None of these
Line bond
When writing an organic functional group, scientists often write an “R” as part of the structure. What does the R indicate? A string of carbon atoms Radon Routine carbon atom Rest of the molecule None of the above
Rest of the molecule
According to the module, the study of NON-carbon compounds is referred to as____.
Organic chemistry Inorganic chemistry Biochemistry Environmental chemistry None of the above.
inorganic chemistry
The \_\_\_\_\_\_\_\_\_\_\_ functional group was NOT discussed in this module. Alcohol Amine Aromatic Thiol All of these were discussed.
all were discussed
Which number would be closest to the approximate number of ribosomes in an E. coli cell? A. 1 B. 25 C. 250 D. 25,000 E. Both c and d
D
Which of the following would most likely have a cell wall? Marigold flower cells Deer cells Heart cells Human red blood cells All of the above
marigold flower cells
Eukaryotes have molecules that provide a protective structure. This network, which is found in all eukaryotes, is called the _____________.
Cell wall Cytoplasm Cytosol Cytoskeleton Both Cell wall and Cytoskeleton
Cytoskeleton
What is the molecule responsible for gout? Luciferin Uric acid Acetic acid Glucose Glycine
uric acid
About how many different elements are found in living organisms? 9 30 50 68 92
30
All cells share a foundational property at the cellular level. Give a brief explanation of this foundational similarity.
The fundamental similarity is that each cell type has a plasma membrane that separates life from non-life. The plasma membrane acts as a barrier to most molecules but does have proteins that permit select molecules to cross via proteins (transporters). The plasma membrane permits the cell to have a different composition of molecules inside the cell than out and defines a space for life to occur.
According to the Module, are smaller elements or large elements favored in biological molecules? Explain which one (smaller or larger) are preferred and give at least two examples of elements (smaller or larger) common in the biomolecules.
Smaller elements are preferred. These elements with smaller atomic shells are favored because they can form stable covalent bonds. Strong bonds form by significant overlap of atoms, such as carbon and hydrogen permitting them to share electrons. The bond that forms requires a substantial amount of energy to break, which allows the bonds to withstand insults, such as mechanical and thermal stresses. This bond strength is good news for living organisms. Stable bonds allow cells to form, hair to grow, and skin to protect against abrasion.
These elements are common: H, C, O, N, P, S, and Cl. (Se is borderline).
Larger elements tend to form ionic compounds–not covalent.
What element is the basis for life? Describe at least two properties of this element that permit it to serve the basis for life.
- Carbon can form strong covalent bonds with a variety of different elements. 2. Besides, carbon can form double and triple bonds with other carbon atoms and other elements (N and o). 3. Carbon can form long chains by forming numerous carbon-carbon bonds; we call these large molecules polymer. 4. Lastly, carbon can form cyclic structures, which are also called ring compounds.
What the definition of inorganic chemistry? How does it differ from organic chemistry?
Inorganic chemistry is the study of all other elements, but carbon. Organic chemistry is the study of carbon-based compounds both in living and non-living organisms. There is no need to have separate sub-disciples for organic and inorganic chemistry, but for historical and organizational reasons, the difference exists.
Biochemists study the communication within and among organisms. According to the module, what are two other aspects of living organisms that biochemists study?
In the module, biochemists also study the structure and function of biomolecules and the chemical reactions of organisms.
The amino acids serine and threonine both contain sulfur atoms.
False
The side chain of leucine is bonded to the backbone nitrogen atom.
False
The name of the molecule that binds to an enzyme is called the ligand.
False
An inhibitor that binds at the active site is a noncompetitive inhibitor.
False
Which amino acids differ by only one atom?
Ser and Cys Ser and Thr Leu and Ile Ala and Ser Asp and Asn
Ser and Cys
The formation of a peptide bond between two amino acids is an example of a(n) \_\_\_\_\_ reaction. Cleavage Condensation Group transfer Isomerization Double-bond breaking
Condensation
The peptide Ala-Glu-Gly-Ala has ______ .
A disulfide bond Five peptide bonds Four peptide bonds Three peptide bonds No C-terminal
Three peptide bonds
Formally, when there are 99 or fewer amino acids are covalently linked together that is called a _________.
Polypeptide Oligopeptide Peptide Protein Polyprotein
polypeptide
What unit is used by biochemists to indicate the mass of a protein?
kDa kBa Mol/g g/mol kg
kDa
All of the 20 standard amino acids contain an R-group that is attached to the:
A) 𝛼 carbon B) Carboxyl group C) Amino group D) 𝛽 carbon E) None of the above
A
Which of the following correctly matches the amino acid with its one letter abbreviation?
Isoleucine, S Lysine, K Phenylalanine, P Glutamic acid, G Arginine, A
Lysine, K
The order of amino acids in a protein is written _________.
3’ to 5’
5’ to 3’
N to C-terminus
C to N-terminus
Smallest to largest amino acid by weight
N to C- terminus
In one turn of a helix, there approximate \_\_\_\_\_\_\_\_\_ amino acids. 2.3 3.6 4.2 5.4 None of the above
3.6
In an alpha helix, the R groups on the amino acid residues:
Alternate between the inside and outside of the helix
Cause only left-handed helices to form
Generate the hydrogen bonds that form the helix
Stack within the interior of the helix
Are found on the outside of the helix spiral
are found on the outside of the helix spiral
Motifs are classified primarily by their:
Amino acid sequence
Evolutionary relationships
Content and arrangement of the secondary structure
Content and arrangement of the tertiary structure
Subunit content and arrangement
content and arrangement of the secondary structure
A single folded polypeptide has a globular shape, which describes its ________ structure.
You Answered Secondary Tertiary Quaternary Quasi Motif
tertiary
How many classes of enzymes are recognized by the IUBMB? 5 6 7 10 25
6
An enzyme requires Cr+3 for catalysis. Under conditions of chromium deficiency, when the enzyme lacks chromium, this enzyme would be referred to as a(n): Holoenzyme Apoenzyme Active enzyme Inhibitor Competitive inhibitor
apoenzyme
When a substrate has just started its conversion to a new molecule, it is said to be in the ________.
Stable mode Unstable mode Transition state Conversion State Conversion Mode
transition state
Which of the following would change the rate of an enzyme-catalyzed reaction?
amino acids, concentration, and temperature
pH, concentration, and temperature
pH, polarity, and concentration
polarity, concentration, and temperature
pH, polarity, and temperature
pH, concentration and temperature
The concept of induced fit refers to the fact that:
When a substrate binds to an enzyme, the enzyme induces loss of water
Enzyme specificity is induced in the enzyme-substrate
The enzyme-substrate binding increases the temperature
Substrate binding induces a conformation change in the enzyme
The substrate bends and twists before it binds to the enzyme
substrate binding induces a conformation change in the enzyme
The ES stands for:
Enzyme-substrate Energy-substance Enzyme-specificity Energy-specificity None of the above
Enzyme substrate
Any molecule or ion that is necessary for an enzyme’s function is called a: Cofactor Coreactant Coproduct Bienzyme Both B and C
cofactor
Staphylokinase is said to be a dimer. A) What is a dimer? B) Structurally, a dimer describes what level of protein organization?
A) This enzyme has two independent polypeptide chains interacting non-covalently. In this case, they are identical chains.
B) It is describing the quaternary structure, which has two or more independent polypeptide chains that associate with one another to form a quaternary structure.
There are collections of protein structure that fit between true secondary and true tertiary structure. What is the name of the collections of protein structure? Explain this type of structure.
Motifs occupy a position between secondary and tertiary. Motifs are particularly stable arrangements of secondary structure, including the connections between them. Motifs are found in a variety of proteins from across all organisms.
What is the lowest level of protein structure? And B) How do scientists communicate information about this level?
The primary level is the order of amino acids covalently bonded together, including disulfide bonds, in a polypeptide chain. The primary sequence is written, for proteins, from N to C terminal using the one-letter or three-letter abbreviations.
Define the term “active site.”
The active site is the spot on the enzyme where catalysis takes place. This area is often small when compared to the overall size of the protein. In fact, about 10 amino acids make up the active site.
The pH of a solution of 2.5 x 10-5 M NaOH is:
A. 9.4
B. 2.5 x 10-5
C. 9.5
D. 9.0
E. 9.12
A
Water is a unique molecule. Which of the following contributes to water’s unique place in the chemical world?
The geometry of the molecule
The polarity of the O-H bonds
The ability of water molecules to hydrogen bond
The bond angle of water
All of the answers are correct
All the answers are correct
What factor contributes to the bent shape of a water molecule?
The dipole arrows in a water molecule
The unshared electron pairs on the oxygen atom
The electronegativity difference between hydrogen and oxygen
The unequal electron sharing between hydrogen and oxygen
None of the answers are correct
The unshared electron pairs on the oxygen atom
The H+ concentration of a solution is 5.6 x 10-5 What is the pH?
- 4.25
- 25
- 65
- 9.75 - 75
4.25
If the Ka of an acid is 2.67 x 10-5, what is the pKa?
- 45
- 25
- 26
- 67
- 57
4.57
List the acids in INCREASING order of strength (weakest to strongest):
Nitrous acid (Ka = 4.0 x 10-4); acetic acid (Ka = 1.7 x 10-5); phosphoric acid (Ka = 7.3 x 10-3)
Nitrous acid, acetic acid, phosphoric acid
Acetic acid, nitrous acid, phosphoric acid
Phosphoric acid, nitrous acid, acetic acid
Acetic acid, phosphoric acid, nitrous acid
None of the above
acetic acid, nitrous acid, phosphoric acid
Elemental bromine (Br2) is a liquid at room temperature. What is the dominant attractive force that exists between Br2 molecules in the liquid?
Halogen forces Dipole-dipole forces Hydrogen bonds Covalent bonds London forces
London forces
Which one of the following molecules can form a hydrogen bond?
A. HBr
B. HCl
C. NH3
D. CH4
E. H2
C
A hydrogen bond can form between a hydrogen atom bonded to nitrogen, N–H, and ________.
C O Cl P Br
Oxygen
In a bond between P and Cl, there exists a difference in electronegativity resulting in partial positive and partial negative charges. If a dipole arrow were added to this structure, which way would the arrow point?
M2 Exam 11b.png
The arrow points from Br toward N
The arrow points from N toward Br
Two arrows; one pointed in each direction
There would not be a dipole arrow in this case.
None of the above
arrow points between N and Br
The following reaction occurs in glues purchased from hardware stores. Customers use this product to glue plastic together.
Epoxy (l) + hardener (l) ⟶ Glue (s) + heat given off
What is the sign (+ or -) of the change in ΔG and ΔH?
A) ΔG is (+) and ΔH is (-)
B) ΔG is (-) and ΔH is (-)
C) ΔG is (-) and ΔH is (+)
D) ΔG is (+) and ΔH is (+)
E) None of the above
B
Which of the following is the free-energy change of a reaction?
A) G
B) ΔS
C) ΔH
D) ΔG
E) All of the above
D
Which of the following is the change in entropy of a reaction?
A) ΔG B) ΔE C) ΔH D) ΔF E) None of the above
E
Which buffer system is used by the blood to maintain pH balance?
Vinegar buffer system Acetic acid buffer system Bicarbonate buffer system Water buffers system Formic acid buffer system
Bicarbonate buffer system
A buffer can neutralize only a certain amount of acid and base. We say that this is its: Buffer limit Buffer range Buffer maintenance Buffer capability Buffer capacity
buffer capacity
Is a pH of 8.36 acidic, neutral, or basic? Acidic Neutral Basic Both Acidic and Basic Both Neutral and Basic
Basic
The “ion product” is equal to what value?
A. 1.0 x 10-14
B. 1.0 x 10-7
C. 2.1 x 10-7
D. 5.6 X 10-13
E. None of the abo
A
n equilibrium constant expressions, the double brackets [ ] indicate: The ion product Acid Base Concentration in molarity The acid dissociation constant, Ka
concentration in molarity
A pH = 5.0 indicates a concentration of OH- (in M) of __________.
A. 5
B. 10-5
C. 10-9
D. 10-1
E. 101
C
Which of the following compounds would not be soluble in water?
A. NaCl
B. OH-
C. Glucose
D. Wax
E. All of the above would be soluble
D
The oxygen in water has what type of hybridization?
A. sp
B. sp2
C. sp3
D. sp3d
E. All of the above
C
Three identical molecules dissolve in water. Each molecule contains both a polar portion and nonpolar portion of structure. The three molecules interact in such a way that the nonpolar sections align. This is an example of the _________.
Hydrophilic rule Hydrophobic effect Buffering capacity Hydrogen bonding effect All of the above
Hydrophobic effect
How does the strength of a covalent bond compare to the strength of London Forces and hydrogen bonds? Briefly comment on these differences.
A typical covalent bond is around 400 kcal, while a London force is less than 1 kcal. So, a covalent bond is at least 400 times the size a London force.
The hydrogen bond strength is between 12 and 16 kcal, which makes the covalent bond about 40 times a hydrogen bond. Moreover, hydrogen bonds are the strongest non-covalent force, so this is significant.
t cool temperatures, water vapor turns into liquid water releasing heat in the process. Fill in the missing blanks, below, regarding this process. Please identify your answers by writing “A.” then your answer, “B” then your answer, and so forth.
The free-energy change, ΔG, has a _____A______ value (choose “+” or “-“).
The enthalpy change, __B___ (fill in symbol), has a ___C_____ value (choose “+” or “-“).
The _____D______change, (ΔS), has a ______E_____ value (choose “+” or “-“).
A) “-“
B) ΔH
C) “-“
D) entropy
E) “-”
A group of molecules forms a clathrate in water. What is a clathrate and why does it form?
The hydrophobic effect helps scientists explain how biological molecules form and interact. For instance, when molecules with both a nonpolar and polar regions dissolve in water, the nonpolar regions pack together. The packing of the nonpolar regions minimizes the interaction with water and the polar region interact with water, which in total is called the hydrophobic effect. The driving force behind this effect is the spontaneous drive of water to bind to itself through hydrogen bonds. To maximize the hydrogen bonds, water orders itself around the hydrophobic portion of the nonpolar regions in a cage structure also called a clathrate. In so doing, water can form bonds with itself and also permit the nonpolar regions to be dissolved.
