2.1 Study Guide

Question 1

Which is true about the structure of DNA
a. The two strands run parallel to one another in the same direction
b. The major groove is twice as wide as the minor groove
c. Each turn of the helix is 23 Angstroms in length
d. The backbone consists of ribose and phosphate
e. None of the above

Answer 1

None of the above

Question 2

Which is true about cyclic cAMP
a. It acts as the energy currency in our cells
b. It contains a phosphodiester bond
c. It is a cofactor for metabolic enzymes
d. All of the above
e. None of the above

Answer 2

It contains a phosphodiester bond

Question 3

Would this nucleic acid sequence form a hairpin structure? ATGATGCTGATGATTAGTAGTCGTAGTA
a. Yes, because it is a mirror repeat
b. No, because it is a mirror repeat
c. Yes, because it is a palindromic repeat
d. No, because it is a palindromic repeat

Answer 3

No, because it is a mirror repeat

Question 4

Which is more stable DNA or RNA

Answer 4

DNA

Question 5

In DNA what is the result of cytosine deamination
a. Conversion of cytosine to uracil
b. Loss of purine bases
c. Destabilization of the deoxyribose/phosphate backbone
d. formation of cyclobutyl rings between nitrogenous bases
e. RNA editing

Answer 5

Conversion of cytosine to uracil

Question 6

Which is true about RNA editing
a. It doesn’t occur in mammals
b. It occurs through cytosine deamination
c. It generates inosine, which can base-pair with uracil, adenine or cytosine
d. It never changes the coding region of mRNA
e. It occurs spontaneously through a nonenzymatic reaction

Answer 6

It generates inosine, which can base-pair with uracil, adenine or cytosine

Question 7

RNA secondary structure is essential for RNA silencing because
a. A hairpin conformation with a specific stem length and loop diameter is required for microRNA
processing by DICER
b. A specific hairpin conformation is required in the 3’ UTR of mRNA that are targeted for degradation
by microRNA
c. Secondary structure in microRNAs acts as a ribozyme to degrade target mRNAs
d. All of the above
e. None of the above

Answer 7

A hairpin conformation with a specific stem length and loop diameter is required for microRNA
processing by DICER

Question 8

What is a ribozyme?
a. A sensor-containing mRNA that regulates its own translation
b. A protein that assembles ribosomes
c. An RNA-editing enzyme
d. An RNA with catalytic activity

Answer 8

An RNA with catalytic activity

Question 9

Which is not a domain in riboswitches?
a. Aptamer domain
b. Expression platform
c. Repressor domain
d. Switching domain
e. All of these are domains in riboswitches

Answer 9

Repressor domain

Question 10

What is the result of thiamine binding to the ThiM riboswitch?
a. Thiamine binding represses mRNA transcription
b. Thiamine binding promotes mRNA transcription
c. Thiamine binding represses mRNA translation
d. Thiamine binding promotes mRNA translation
e. Thiamine binding causes mRNA degradation

Answer 10

Thiamine binding represses mRNA translation