Unit 3 - M/C Flashcards
What is the most important technical issue that needs to
be overcome for a COVID PCR test to work?
A. Chemical contaminants (inhibitors) that reduce DNA amplification
success by interfering with Taq DNA polymerase.
B. Degradation of DNA template by DNAses in nasal mucous.
C. Absence of SARS-CoV-2 genomic DNA in the sample.
D. Sourcing critical materials needed for the test that are in short supply because of global pandemic-related supply chain issues.
The most important technical issue that needs to be overcome for a COVID PCR test to work is likely option C, the absence of SARS-CoV-2 genomic DNA in the sample. PCR tests rely on the presence of specific genetic material from the virus to detect its presence. If the virus is not present or is present in very low quantities in the sample, the test may produce false-negative results.
Frank has Klinefelter syndrome (47, XXY). His mother has normal skin, but his father has anhidrotic ectodermal dysplasia, an X-linked condition where the skin does not contain sweat glands. Frank has patches of normal skin and patches of skin without sweat glands.
Complete the sentences. Some answers may be used more than once or not at all.
Frank received the mutant chromosome from his _________. Nondisiunction occurred in his ________ during the ________ meiotic division.
Answer Bank: Father, Mother, first, second
Father, Father, First
Red-green color blindness is a human X-linked recessive disorder. The normal allele, X, is dominant to the mutant allele, X. Jill has normal color vision, but her father is color blind. Jill marries Tom, who also has normal color vision. Jill and Tom have a daughter who has Turner syndrome and is color blind. How and from whom did the daughter inherit color blindness?
a) an ovum carrying XB followed by fertilization by sperm from a paternal nondisjunction event
b) a maternal nondisjunction followed by fertilization by sperm carrying XB a
c) maternal nondisjunction followed by fertilization by sperm lacking sex chromosomes
d) an ovum carrying X followed by fertilization by sperm from a paternal nondisjunction event
e) a maternal nondisjunction event followed by fertilization by sperm carrying Xb
d) an ovum carrying X followed by fertilization by sperm from a paternal nondisjunction event
loss-of-function mutation vs gain-of-function mutation
A mutation that results in reduced or absent protein function.
vs
A mutation that results in a new or additional protein function.
intergenic suppressor mutation vs intragenic suppressor mutation
A mutation in a separate gene that masks another mutation.
vs
A mutation within the same gene that masks another mutation.
Which is an example of a transversion mutation?
a) Guanine is replaced by adenine.
b) Thymine is replaced by uracil.
c) Cytosine is replaced by thymine.
d) Thymine binds to a neighboring thymine base.
e) Adenine is replaced by thymine.
e) Adenine is replaced by thymine.
Suppose a point mutation, such as a change from an adenine to a guanine, occurs in the genome of a human sperm cell. The mutation could occur in any region of a gene. The effect of the mutation on the phenotype of the offspring will be determined by where the mutation occurs and its effect on the final gene product. In which scenarios could the mutation alter the phenotype of the offspring?
a) The mutation occurs in a codon, and the amino acid sequence of the final protein is unchanged.
b) The mutation occurs in a gene that controls development and alters differentiation of a cell type during development.
c) The mutation occurs in a codon and alters the function of the final protein.
d) The mutation occurs in the promoter and affects the rate of gene transcription.
e) The mutation results in a new, dominant allele.
f) The mutation occurs in a portion of an intron not responsible for exon splicing.
b) The mutation occurs in a gene that controls development and alters differentiation of a cell type during development.
c) The mutation occurs in a codon and alters the function of the final protein.
d) The mutation occurs in the promoter and affects the rate of gene transcription.
e) The mutation results in a new, dominant allele.
In the lower half of the interactive, change the template DNA strand such that the sequence:
…..ACAAAC….. is changed to
…..ACATAC…..
Which of the terms correctly describes this type of mutation?
a) deletion
b) substitution
c) insertion
d) inversion
If this mutation occurred in a protein-coding gene, how would it be classified?
a) frameshift mutation
b) missense mutation
c) silent mutation
d) nonsense mutation
b) substitution
b) missense mutation
Which examples are induced mutations?
a) Transposition causes the formation of insertions.
b) Nitrous acid causes the deamination of adenine to hypoxanthine.
c) Errors in DNA replication cause the formation of point mutations.
d) Ionizing radiation causes chromosomal fragmentation.
b) Nitrous acid causes the deamination of adenine to hypoxanthine.
d) Ionizing radiation causes chromosomal fragmentation.
Consider the DNA sequence.
5’ACGTTCCAGTCAATGAGCACGTAGGCTCTGCATACAGCGAATCA3’
3’TGCAAGGTCAGTTACTCGTGCATCCGAGACGTATGTCCTTAGT5’
Select the pair of primers that are appropriate for amplifying the sequence of DNA during a polymerase chain reaction (PCR).
a) 3’ ACGTATGTCGCTTAGT 5’
b) 3’ TGCA 5’
c) 5’ ACGTTCCAGTCAATGA 3’
d) 5’ GCCATAGTAT 3’
e) 5’ ‘TTCC 3’
f) 3’ CGGTATCATA 5’
a) 3’ ACGTATGTCGCTTAGT 5’
c) 5’ ACGTTCCAGTCAATGA 3’
Polymerase chain reaction (PCR) is a technique used to amplify (copy) DNA. Suppose a single, linear molecule of double-stranded DNA (dsDNA) is amplified by PCR.
a) After one PCR cycle, how many molecules of dsDNA will there be?
b) After three PCR cycles, how many molecules of dsDNA will there be?
c) After 30 PC cycles (a typical number of cycles), how many molecules of dsDNA will there be?
a) 2
b) 2^n = 2^3 = 8
c) 2^30 = 1 billion
Order the steps required to sequence a region of DNA using dideoxy sequencing:
- DNA polymerase extends the primer, incorporating deoxynucleotides
- denature the double-stranded DNA
- gel electrophoresis separates the mixture of DNA fragments by size
- add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase
- a primer binds to the single-stranded DNA template
- a labeled, dideoxynucleotide terminates the growing DNA chain
In order:
…amplify region of DNA….
4. add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase
2. denature the double-stranded DNA
5. a primer binds to the single-stranded DNA template
1. DNA polymerase extends the primer, incorporating deoxynucleotides
6. a labeled, dideoxynucleotide terminates the growing DNA chain
3. gel electrophoresis separates the mixture of DNA fragments by size
…DNA sequence is determined…
How does next-generation (next-gen) sequencing differ from traditional sequencing?
NEXT GEN:
- the DNA fragments are attached to a substrate before DNA sequencing begins.
- millions of DNA fragments can be sequenced at a time
- the DNA sequence is read during the DNA replication process.
TRADITIONAL:
- the sequence products must be separated by gel electrophoresis.
- a maximum of a few hundred DNA fragments can be sequenced at a time
- the DNA sequence is interpreted from the variation in length of the DNA products generated.
Order the events that occur in one cycle of the polymerase chain reaction (PCR).
- The double-stranded DNA is denatured to form single-stranded DNA.
- Tag DNA polymerase extends the primer.
- The temperature of the reaction mixture is lowered to allow the primers to anneal to the DNA template.
- The reaction mixture is heated to 94 °C.
- The reaction mixture is heated to 72 °C.
In order:
…The reaction mixture contains two copies of a particular DNA sequence…
- The reaction mixture is heated to 94 °C.
- The double-stranded DNA is denatured to form single-stranded DNA.
- The temperature of the reaction mixture is lowered to allow the primers to anneal to the DNA template.
- The reaction mixture is heated to 72 °C.
- Tag DNA polymerase extends the primer.
…The reaction mixture contains four copies of the DNA sequence….
Chromosome duplications and deletions frequently result in abnormal phenotypes or inviable gametes. Which factor is a major contributor to this phenomenon?
a) The genes are found in a novel arrangement.
b) Gene dosage is modified.
c) Recessive diseases are unmasked by additional copies.
Why are these effects less noticeable for multisomies and monosomies of the X chromosome in humans?
a) The X chromosome is not necessary for human survival.
b) X inactivation only allows one X chromosome to be expressed in any given cell.
c) The X chromosome only has a few genes.
b) Gene dosage is modified.
b) X inactivation only allows one X chromosome to be expressed in any given cell.
