Unit#2 MCB

Question 1

What is the most common use of northern blotting?

A. Measuring the level of expression of specific genes in different tissues

B. Detecting RFLP’s

C. Detecting SNPs

D. Measuring the amounts of a specific tRNA in different tissues.

E. Measuring the amounts of a specific protein in different tissues.

Answer 1

A. Measuring the level of expression of specific genes in different tissues.

Northern Blotting: * Detect RNA molecules of specific sequence and determine their size * Semi-quantitative * Detect Differences in expression between different tissues (Gene expression analysis) * Detect alternatively spliced transcripts.

Question 2

A 35-year-old male is receiving chemotherapy for a brain tumour. He has been prescribed vinblastine as part of his chemotherapeutic regimen. Vinblastine functions to block mitosis by which of the following means?

A. Hydrolyzing tubulin-GTP, promoting rapid microtubule depolymerisation

B. Binding to free tubulin dimers preventing polymerisation

C. Preventing microtubule formation by capping and severing the growing end.

D. Preventing formation of the contractile ring during cytokinesis

E. Stabilizing existing microtubules, preventing recycling of tubulin dimers.

Answer 2

B. Binding to free tubulin dimers preventing polymerization.

Vincristine, vinblastine and colchisine all block microtubule polymerization by binding to the tubulin dimers, Paclitaxel blocks microtubule depolymerization by stabilizing existing microtubules.

Question 3

A Plasmid is:

a. an ionized gas
b. single-stranded DNA
c. A viral vector
d. Capable of self replication in a bacterial host.
e. A type of flat-screen TV

F. about 10^6 bp in size.

Answer 3

Answer: D. Capable of self-replication in a bacterial host.

Question 4

Vectors:

Answer 4

*Carry the DNA of interest.

*Modified from naturally occurring vectors.

*Replicate in the host, independently of the host genome

*Modified to allow easy cloning, antibiotic selection, gene expression, etc. Examples:

1. Plasmids are widely used, carry relatively small loads of cDNAs
2. Bacterial Artificial Chromosomes (BACs), carry larger loads, for example genomic chromosomal fragments
3. Viral Vectors, are mainly used for delivery of DNA into animals/humans for example in gene therapy.

Question 5

Total proteins are isolated from a muscle biopsy. The proteins are separated by SDS-PAGE and then blotted to a PVDF membrane. The dystrophin protein is then detected using a dystrophin-specific antibody. The Technique is know as…. A. Southern Blotting

B. Western Blotting

C. Northern Blotting

D. South-western Blotting

E. Eastern Blotting.

Answer 5

A. Western Blotting Western Blotting:

1. Proteins are separated by SDS-PAGE
2. Transferred to a membrane
3. Probed with an antibody against the protein of interest.
4. Enzymatic detection of the antibody . Detect specific Proteins and determine their size. . Semi quantitative . Detect differences in expression between different tissues.

Question 6

A biotech company is developing a gene therapy that might extend the life of humans and is based on the over expression of a gene that protects cells from harmful superoxides generated by the Mitochondria. They want to test their strategy in a mouse model before beginning clinical trials in humans. The gene driven by an augmented promoter is inserted into an expression vector and microinjected into a mouse oocyte. the oocyte is mated with a sperm cell in vitro, and the new zygote is then implanted into a pseudopregnant female. What is the best term for the offspring that result?

A. Cloned Mice

B. Treated Mice

C. Transgenic Mice

D. Knock-out Mice E. Knock-in-Mice

Answer 6

C. Transgenic Mice Transgenic Organisms:

* Organisms that have had exogenous DNA added to their genomes that can be stably transmitted in a heritable manner.

* Aka. Genetically engineered or genetically modified organisms.

Transgene:

* The exogenous DNA that is added to the organism. In simple transgenics, the transgene incorporates randomly into the genome. ( Usually gain-of-function)

Question 7

Knock-in-Mice

Answer 7

Knock-in-animals. .

A transgenic animal in which a specific mutation or modification is introduced into both endogenous copies of a gene . May be gain-of-function or a specific loss-of-function mutation.

Question 8

You have isolated a novel human brain protein that plays a role in Parkinson’s Disease. you have sequenced the protein and inferred the coding sequence of the gene. you would like to obtain the coding sequence by screening a library. Which type of library is most appropriate to screen?

A. Genomic DNA BAC library

B. Genomic DNA viral Library

C. Muscle cDNA plasmid library

D. Brain cDNA plasmid library.

E. Muscle expression library

Answer 8

D. Brain cDNA plasmid Library cDNA Library

* A library of cDNA molecules (Plasmid vectors)

* Represents all mRNAs present in a particular cell or tissue.

* There is kidney, liver, cerebrum….. cDNA libraries.

Question 9

After activation of a calcium dependant cell signaling pathway, PKC is activated. Which second messenger or protein is needed for PKC activation?

a. CREB
b. GRB2
c. DAG
d. RAS
e. cAMP

Answer 9

c. DAG

PKC activation follows the PLC pathway activated by GPCRs or RTKs. PLC cleaves inositol phospholipid generating IP3 (which triggers release of Ca2+ into the cytoplasm) and DAG which activate PKC. cAMP and CREB are part of the PKA pathway. RAS and GRB2 are part of the RAS-MAPK pathway.

Question 10

Cyclic AMP (cAMP) is …

A.a messenger of low energy in the cell

B.formed by adenylyl cyclase

C. a hormone

D.a type of G-protein

Answer 10

B. Formed by adenylyl cyclase

Correct. cAMP is a second messenger formed by adenylyl cyclase.

Question 11

When describing heterotrimeric Gproteins, the binding of the signal molecule ( such as a hormone) to the receptor results in….

A. binding of ATP

B. receptor dimerization

C. activation of the tyrosine kinase domain

D. Dissociation of the alpha subunit.

Answer 11

D. Dissociation of the alpha subunit.

The binding of the singal molecule on the outside of the cell to its receptor results in herotrimeric G proteins dissociating in the cytosol. The alpha subunit will separate from beta/gamma and activate the effector protein.

Question 12

Inositol 1,4,5 trisphosphate (IP3) is a second messenger thaat triggers the release of Ca2+ from the endoplasmic/sarcoplasmic reticulum.

True/False

True, but only after activation of cAMP phosphodiesterase.

Answer 12

True

Question 13

The peptide-based class of hormones cannot pass through the plasma membrane to enter the cell. The act indirectly through a special class of membrane receptor proteins to produce a “second messenger” inside the cell. Many of these receptors activate an enzyme to generate the second messenger. how do these proteins turn the enzyme on?

A. Through proteolytic activation of nuclear ion channels

B. Through activation of a G-stimulatory protein complex

C. Through activation of an intracellular HSP90 complex

D. Through recruitment of chaperon molecules that carry the hormone inside the cell.

Answer 13

B. Through Activation of a G-stimulatory protein complex.

Good. There is a large class of G-protein coupled receptor proteins that share this common mechanism. Binding of the hormone changes the conformation of the receptor so that an associated GTP-binding trimer of proteins is caused to dissociate. The alpha-subunit, with bound GTP, will bind to a specific enzyme and promote its activity to form the second messenger that spreads throughout the cell.

Question 14

A 20 year old male patient presents with yet another episode of bronchitis. After taking his history it transpires that he and his girlfriend have been trying to conceive for over a year and that he suffers from chronic paranasal sinusitis. You already suspect several diagnoses and order a chest x-ray, which reveals situs inversus. your final diagnosis is confirmed by a mutation in:

A. Myosin V

B. Myosin II

C. Axonemal Dynein

D. Cytosolic Dynein

E. Kinesin.

Answer 14

C. Axonemal Dynein

The condition described is Kartageners syndrome, a primary ciliary dyskinesia in which cilia and flagella are unable to bend due to the defective gene mutation.

Question 15

Vesicular transport along microtubules requires the activity of _______ to get from the ER and Golgi to the plasma membrane:

A. Myosin V

B. Dynein

C. Troponin C

D. Kinesin

E. Myosin II

Answer 15

D. Kinesin

Dyneins and Kinesins are the motor proteins that travel along microtubules. Kinesins walk towards the positive end. Myosins walk along the actin filaments.

Question 16

Dinitrophenol (DNP) is lipid-soluble and can, therefore, diffuse across the membrane. It has a dissociable proton with a pKa near 7.2. Thus, in the intermembrane space where [H+] is high (pH low), DNP picks up a proton, which it carries across the membrane. At the lower proton concentration of the matrix, the H+ dissociates. As a consequence, what would you expect?

A.Decreased ATP production

B.Increased CO2 excretion

C.Increased efficiency of the electron transport chain (ETC)

D.No changes in electrochemical gradient

Answer 16

A. Decrease ATP production

Correct. DNP acts as an uncloupler, just like the protein thermogenin.

Question 17

An antibiotic is being developed to treat a bacterial infection. The drug is being designed to interfere with the synthesis of a cell component. Which of the following would be the most effective target?

A. Cell membrane

B. Cell Wall

C. Chromosomes

D. Lysosomes

E. Nucleus

Answer 17

B. Cell Wall

Excellent, the wall is the only choice that is unique to bacteria and not present in human cells, which makes it an ideal target for a new antibiotic.

Question 18

An unequal distribution of Ran/GTP across the nuclear envelope is maintained by the localization of Ran GAP (Ran GTPase-activating protein) in the cytoplasm and Ran GEF (Ran guanine nucleotide exchange factor) in the nucleus. When Ran GAP hydrolyzes GTP of Ran/GTP in the cytoplasm which of the following happens next?

A. Inactivated Ran releases importin/exportin

B. Ran replaces GDP with GTP immediately in the cytoplasm

C. Inactivated Ran carries the exportin back to nucleus

D. Ran binds importin/exportin

Answer 18

A. Inactivated Ran releases importin/exportin

Question 19

Which of the following components of the electron transport chain is involved in apoptosis?

Answer 19

A. Cytochrome c oxidase (Complex IV)

Question 20

Hepatosplenomegaly, aseptic necrosis of femur, bone crisis and macrophages that look like crumpled tissue paper- these are symptoms of which of the following diseases?

A. Gaucher’s Disease

B. Tay-Sachs disease

C. Niemann-Pick disease

D. Fabry’s Disease

Answer 20

A. Gaucher’s Disease

Question 21

All of the following are transmembrane enzymatic proteins that span the inner mitochondria membrane except?

A. NADH dehydrogenase (Complex I)

B. Succinate Dehydrogenase (Complex II)

C. Cytochrome b-c1 complex. (Complex III)

D. Cytochrome c oxidase (Complex IV)

E. ATP Synthase.

Answer 21

B. Succinate Dehydrogenase (Complex III)

Correct. Complex II does not cross the inner mitochondrial membrane.

Question 22

In rare acquired diseases such as paroxysmal nocturnal hemoglobinuria (PNH) and congenital diseases such as hyperphosphatasia with mental retardation syndrome (HPMRS), patients lack proteins attached to the outer leaflet of the plasma membrane. These disorders are caused by a deficiency in the synthesis of…

A. Cholesterol

B. Glycosylphospatidylinosytol

C. Phosphatidylserine

D. Phophatidylserine

E. Sphingomyelin

Answer 22

B. Glycosylphospatidylinositol.

Correct. GPI serves as an anchor for membrane proteins.

Question 23

Sanfilippo syndrome is a rare autosomal recessive genetic disease. It is caused by a deficiency in one of the enzymes needed to break down the glycosaminoglycan (GAG) heparan sulfate (which is found in the extracellular matrix and on cell surface glycoproteins). How would you classify this genetic disorder?

A. Leukodystrophies

B. Mucolipidoses

C. Mucopolysacharidoses

D. Sphingolipidoses

Answer 23

C. Mucopolysacharidoses.

Correct! Mucopolysacharidoses involve an accumulation of sulfated polysacharides or GAGs.

Question 24

Where are ribosomal proteins synthesized?

A. In cytoplasm by free ribosomes.

B. In rough ER by attached ribosomes

C. Inside the nucleolus

D. Inside the nucleus

Answer 24

A. In cytoplasm by free ribosomes.

Question 25

Imagine that following translation, the carboxy terminal amino acid of the cell surface insulin receptor is hydroxylated by a cytosolic enzyme. After insertion of the receptor into the plasma membrane, what fluid compartment is bathing this modified amino acid? A. Cytosol B. Extracellular fluid C. Lipid region bilager.

Answer 25

A. Cytosol Excellent! The insulin receptor is a transmembrane protein that will therefore be transported from the ER to the Golgi and then plasma membrane, by default. Its carboxy terminus is modified by a cytosolic enzyme and therefore it must be in the cytoplasm, therefore the amino terminus must have been translocated into the ER lumen. As transmembrane proteins follow the secretory pathway, they will be carried in a vesicle to the plasma membrane and following membrane fusion, all soluble proteins will be secreted into the extracellular space and the ER-luminal part of any transmembrane proteins will therefore now be in the extracllular space (most protein glycosylation occurs in the Golgi and therefore transmembrane proteins have sugar chains attached on the outer leaflet side).

Question 26

All of the following disorders are associated with defects on lamin A/C, except: A. Mucolipidosis II B. Dilated cardiomyopathy C. Emery-Dreifuss muscular dystrophy D. Progeria

Answer 26

A. Mucolipidosis II. Correct. Mucolipidosis is a type of lysosomal storage disease.

Question 27

Which of the following statements is correct about glycolipids? A. Phosphatidylethanolamine is the prototype example of glycolipids. B. Flippases catalyze their "flip-flop" movement from the inner and outer leaflet in the plasma membrane. C. They play a role in cell-cell recognition and nerve conduction. D. They are classified into one of three groups: integral, peripheral or lipid anchored.

Answer 27

C. They play a role in cell-cell recognition and nerve conduction. Correct. These are two key roles of glycolipids. They also aid on protection of cell surfaces.

Question 28

A patient you examined had a special condition in which her peroxisomes were temporarily inactive. Which of the following do you expect to be present? A.Decreased formation of clathrin-coated vesicles B.Decreased synthesis of plasmalogen C.Increased beta-oxidation of VLCFA D.Increased degradation of purines

Answer 28

B. Decreased synthesis of plasmalogen. Correct. Plasmalogen formation takes place in peroxisomes, and a temporarily inactive peroxisome will reduce its synthesis.

Question 29

Which of the following is not found as part of the plasma membrane? A. Triacylglycerol B. Cholesterol C. Glycosphingolipids D. Phosphatidylcholine E. Phosphatidylserine

Answer 29

A. Triacylglycerol Good choice. Triacylglycerols or TAGs do not have a polar region and are not found embedded in the plasma membrane. They can be found as stores in adipocyte cells or as part of the core of various lipoproteins, such as chylomicrons and VLDLs (to be covered in detail in MCB2).

Question 30

Which of the following coat proteins is involved in receptor mediated endocytosis of vesicles containing the LDL receptor? A.Clathrin B.COP I C.COP II D.Caveolin

Answer 30

A. Clathrin Well done! Clathrin coat proteins form during receptor mediated endocytosis.

Question 31

When a mRNA emerges from the nucleus into the cytosol, it will bind to a ribosome and translation will begin. Which of the following statements is true of proteins destined for secretions? A.The ER signal sequence will bind to the SRP receptor on the ER membrane B.The ER signal sequence will bind to the SRP which will take the ribosome to a receptor on the ER membrane C.Glycosylation occurs exclusively in the Golgi D.If they have a KDEL or KKXX amino acid sequence they will be transported to the basal cell membrane

Answer 31

B. The ER signal sequence will bind to the SRP which will take the ribosome to a receptor on the ER membrane.

Question 32

All of the following are pathways to degradation in lysosomes, except? A. Exocytosis B. Autophagy C. Endocytosis D. Phagocytosis

Answer 32

A. Exocytosis. Correct. Exocytosis is the release of secretory material into the extracellular space.

Question 33

Acatalasemia means the inherited near-total deficiency of catalase activity. Acatalasemia was thought at first to be an asymptotic disorder. In the absence of catalase, neither the Japanese, or Hungarian acatalasemics nor acatalasemic mice had significantly increased blood glutathione peroxidase activity. Which of the following would you expect under this clinical condition? A.a decreased ATP production capacity and increased mitochondrial autophagy B.a decreased hydrogen peroxide removing capacity and increased ROS formation C.an increased level of beta-oxidation of VLCFA D.an increased likelihood of Chédiak-Higashi syndrome

Answer 33

B. A decrease hydrogen peroxide removing capacity and increased ROS formation Correct. Catalase is a key enzyme of the peroxisome where it eliminates hydrogen peroxide.

Question 34

Oxidative phosphorylation is the process of ? A. Converting proteins to amino acids. B. Generating CO2 in the tricarboxylic acid cycle. C. Generating ATP through the electron transport chain. D. Reducing H2O2 to water.

Answer 34

C. Generating ATP through the electron transport chain. Correct. In oxidative phosphorylation, oxygen is used and reduced to water, and ATP is created in the ETC. All other answers are not 'oxidative phosphorylation'

Question 35

A young female presented with a 4-month history of vision problems. You also noticed the paralysis of eye muscles and finger-nose ataxia. What is the most likely initial diagnosis? A.Mitochondrial disease B.Lysosomal storage disease C. Laminopathy D.Disease caused by erythrocytes of abnormal shape

Answer 35

A. Mitochondrial Disease

Question 36

An anemic patient is diagnosed with acanthocytosis (presence of spur cells). Which of the following is most likely to be associated with this disease? A.Truncated expression of L-selectins B.Excess cholesterol in the circulation C.Absence of glycosylphosphatidylinositol (GPI) in the plasma membrane D.Decreased concentration of LDL particles in the blood E.Defective lamin proteins in the nuclear lamina

Answer 36

B. Excess cholesterol in the circulation. Yes, it is excess cholesterol in the membrane of RBCs that causes the deformation of the natural concave shape into something resembling a star. These cells are known as "acanthocytes" or "spur cells", and are sequestered and destroyed by the spleen, causing haemolytic anemia.

Question 37

All of the following statements about hereditary spherocytosis are correct, except: A. It is associated with chronic liver disease. B. RBC's are spheroidal and exhibit low deformability C. Removal of spleen can improve symptoms. D. There is spectrin deficiency. E. It is a type of hemolytic anemia.

Answer 37

A. It is associated with chronic liver disease. Correct. Hereditary spherocytosis is an inherited autosomal dominant genetic disorder.

Question 38

Which test is most appropriate to identify a deletion of 3 exons, with a total of 30 kb deleted, in a woman at risk for carrying a dystrophin mutation? A. FISH B. MLPA C. Karyotyping D. Southern Blotting

Answer 38

B. MLPA Great! MLPA can be used to rapidly and quantitatively scan a large number of loci for deletions simultaneously. Since the woman is at risk for being a carrier, a quantitative technique is necessary. FISH is most often used to detect larger mutations (over 100kb). Southern blotting could be used to detect a 30 kb deletion, however, it is not as reliable as MLPA for detecting carrier status. FISH is also more time consuming than MLPA. Karyotyping does not have adequate resolution to detect a 30 kb deletion.

Question 39

Phospholipids

Answer 39

* Are most abundant * 1 hydrophilic (polar head) OH * 2 hydrophobic (nonpolar)

Question 40

A 23-year old Nigerian woman with sickle cell disease is in her 12th week of pregnancy. She has a family history of the disease and is concerned about the status of her unborn child. A prenatal genetics clinic used pcr to analyze her family for a CA-repeat marker known to segregate with the beta-globin gene. The woman’s pedigree is shown (she is II-2) and the results of the analysis are below it. From the analysis we can determine that the fetus inherited… A. The mother's paternal allele, with wild-type sequence B. The mother's maternal allele, with wild-type sequence C. the mother's paternal allele, carrying the sickle cell mutation. D. An unknown allele from the mother, since the mother is uninformative. E. The mother's maternal allele, carrying the sickle cell mutation.

Answer 40

C. The mother's paternal allele, carrying the sicle cell mutation. Great! This family is an unsual case of an autosomal recessive disease presenting pseudodominance. Pseudodominance normally only occurs when the alleles which determine the phenotype are very common in the populatin. An example of such a situation occurs in regions of Sub-Saharan Africa where the frequency of sickle-cell alleles is extremely high in the population. Nigeria has the highest incidence of sickle-cell in the world. To answer this question follow the 4 steps for allele tracking. Mode of inheritance is autosomal recessive (AR) so the affecteds must be homozygous for the sickle cell mutation. Both parents of affecteds must be carriers (or affected themselves). Determine if the parent(s) in question are informative. Since the disease is AR both the mother (II-2 ) and Father (II-3) of the fetus (III-1) must be informative for the marker. From the gel we see they both have 2 different marker alleles and so are informative. Set the phase. The mother (II-2) is affected so both of her marker alleles must be associated with the sickle cell mutation in the beta-globin gene. The father (II-3) is unaffected and we have no family history for him, so the most likely conclusion is that his marker alleles are associated with wild-type beta-globin genes. Type the fetus. The fetus (III-1) has 2 marker alleles. the larger allele was inherited from the mother (II-2) and therefore. is associated with the sickle cell mutation. The mother (II-2) inherited that allele from her father (I-2), so he must have been a carrier. The fetus herefore inherited the mother's paternal allele with the sickle cell mutation. The alele the fetus (III-1) inherited from the father (II-3) is normal. Remember the association of marker alleles with a disease-causing mutation is family specific. As we see on the gel, the mother (II-2) is heterozygous for the marker, but each of thouse marker alleles came from a different family background-her mother (I-1) and father (I-2). In those different family backgrounds the sickle cell mutation was associated with different marker alleles- the 2 alleles the mother eventually inherited.

Question 41

The famous biotech company Rodda Diagnostics is developing a diagnostic test to detect mutations in the BRCA1 gene. The test will be used in a lucrative government-funded breast cancer screening program. The company plans to develop an ASO hybridization-based test, but this requires the relevant region of the BRCA1 gene first be amplified by PCR. The exon sequence to be amplified is: GAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTG Which of the following pairs of pcr primers can be used to amplify this sequence? A. GAGCCTACAAGA and GAAAATCATTTG B. TCTTGTAGGCTC and GAAAATCATTTG C. TCTTGTAGGCTC and CAAATGATTTTC D. AGAACATCCGAG and GAAAATCATTTG E. GAGCCTACAAGA and CAAATGATTTTC

Answer 41

E. GAGCCTACAAGA and CAAATGATTTTC Well done! The forward primer (ie. The primer on the left) will be identical to the 5' end of the sequence to be amplified. The reverse primer (ie. the primer on the right) will be complimentary to the 3' end of the sequence.

Question 42

A family wants to know if their unborn child will have cystic fibrosis (CF); they already have a 5-year-old daughter. Allele-specific oligonucleotide (ASO) analysis is employed to determine whether the fetus has a deletion of Phe-508, which is associated with CF in a large number of cases. DNA from the fetus is obtained by amniocentesis, amplified by polymerase chain reaction, and tested along with DNA from the child and both parents. Probes complementary to the region spanning the Phe-508 deletion (ΔPhe-508 probe) and to the normal sequence in that region (Normal Probe) are used to hybridize to the DNA obtained from the family. The results are shown above (black indicates a positive hybridization result). It can be concluded that the: ## Footnote A.Mother is not a carrier of cystic fibrosis B.Father has cystic fibrosis C.Child is a carrier of cystic fibrosis D.Fetus will be a carrier for cystic fibrosis E.Fetus will have cystic fibrosis

Answer 42

E. Fetus will have Cystic fibrosis. Well done! In ASO hybridization a positive result is indicated by a black spot (ie. film exposed by the radioactive probe). The mother and father are both positive for both the normal allele (using the normal probe) and the mutant allele (using the ΔPhe-508 probe). They are therefore both carriers. The child born earlier is positive for only the normal allele. She is therefore homozygous normal. The fetus is positive for only the mutant allele and so is homozygous for the mutation and will be affected by cystic fibrosis.

Question 43

A newborn boy delivered using forceps suffered cephalohematoma. Heavier than normal iatrogenic bleeding occurred after a heel stab to collect blood for prenatal testing, and again after an injection of vitamin K. The OBGYN who delivered the boy suspects he may have Hemophilia A even though there was no family history of the disease. Which of the following genetic tests would be most appropriate to use to detect the most common mutation causing the disease? A.Multiplex Ligation-Dependent Probe Amplification (MLPA) B.Comparative Genome Hybridization (CGH) C.RFLP with Southern Blotting D.Fluorescent In-Situ Hybridization (FISH) E.RFLP with PCR

Answer 43

C. RFLP with Southern Blotting Great! The most common mutation causing hemophilia A is a chromosomal inversion that disrupts the F8 gene, creating a null mutation. It's important to understand that a chromosomal inversion is balanced. Neither CGH nor MLPA can detect balanced chromosomal rearrangements. It would also be very difficult to detect such a mutation using FISH, since all of the genomic sequence is still present and FISH probes for the F8 gene would still hybridize to the rearranged chromosome. The inversion would rearrange restriction sites within the locus so RFLP analysis could be used to detect it. RFLP analysis by PCR is generally preferable to Southern Blotting since it is faster and cheaper. However recall that for diagnostic purposes the practical limit of PCR is about 1 kb. In general this would be too small to detect changes due to a large chromosomal inversion. Thus the only genetic test that can be used to detect such an inversion is RFLP analysis by Southern Blotting.

Question 44

The image below shows the results of a gel-electrophoretic separation of a DNA sequencing reaction. What was the sequence of the template strand of the DNA molecule which was being sequenced? ## Footnote A. 5'-TACGGTCAT-3' B. 5'-ATGACCGTA-3' C. 5'-ATGCCAGTA-3' D. 5'-TACTGGCAT-3' E. 3'-TACTGGCAT-5'

Answer 44

D. 5'-TACTGGCAT-3' ## Footnote Well done! Pay close attention to the 5' to 3' directionality of the answer choices! To read the sequence of a sequencing gel, start at the bottom and read up. This gives you the sequence of the strand being synthesized in the 5' to 3' direction (remember the strand being synthesized is labeled, so that is what you see on the gel). The sequence of this gel is: 5'-ATGCCAGTA-3' However the question asks for the sequence of the template strand! The sequence of the template strand is the reverse complement of the strand being synthesized. Remember complementary sequences always have opposite directionality. So the answer (in the 5' to 3' direction) is: 5'-TACTGGCAT-3'

Question 45

The below image represents an RFLP analysis of a family with an infant with Down Syndrome. The analysis was performed using a probe which hybridizes to a polymorphic region of chromosome 21 located near the centromere. The mother's and father's alleles are compared to their child's. The trisomy 21 of the child resulted from a meiotic nondisjunction in one of the parents. In which meiotic division did the nondisjunction occur? ## Footnote A.Paternal Meiosis II B. Maternal Meiosis II C. Maternal Meiosis I D. Paternal Meiosis I

Answer 45

B. Maternal Meiosis II ## Footnote Well done! Looking at the rflp result, both the mother and father's genomic DNA produced 2 bands in the analysis. Since this analysis is for a locus on chromosome 21 (an autosome), we know both parents have 2 alleles, so each band represents one allele. The child on the other hand has 3 alleles (consistent with trisomy 21), one smaller allele closer to the bottom of the blot, and two copies of a larger allele closer to the top of the blot (the thicker band results from double the amount of genomic DNA in the child for that allele and so indicates 2 alleles). A child inherits their alleles from their parents - normally one allele from each parent, however in this case a non-disjunction resulted in the child inheriting 2 chromosomes (and therefore 2 alleles) from one of the parents. The child's smaller allele is identical in size to the fathers smaller allele - thus this represents the allele the child's paternal allele. The child's larger 2 alleles are identical in size to the mothers larger allele - thus these 2 alleles were inherited from the mother. Since two alleles came from the mother we know the non-disjunction was maternal. Since the two alleles are two identical copies of the mothers larger allele, the non-disjunction must have occurred in meiosis II. To think about: what would the child's rflp bands look like if the non-disjunction happened in maternal meiosis I?

Question 46

Researchers conducted a study to determine the frequency of a single nucleotide polymorphism (SNP) in the androgen receptor gene. To detect the SNP the researchers designed allele-specific PCR primers as outlined in the below figure. Two alternate forward primers were designed, one matching the wild-type allele (fwd-wt), one matching the snp allele (fwd-snp). A common reverse primer (rev) was also designed. Four individuals (I, II, III and IV) were tested for the presence of the SNP by allele-specific PCR. For each individual two PCRs were performed, one with the fwd-wt primer and one with the fwd-snp primer. The common rev primer was used for all PCRs. The PCR products were analyzed by agarose gel electrophoresis and the results are shown at the bottom of the figure. Which of the individuals is homozygous for the SNP? A. IV B. Both II and IV C. I D. III E. II

Answer 46

D. III Great! In allele-specific PCR a positive result is indicated by a band on the gel. In this allele-specific PCR, the fwd-wt primer will produce a PCR product (a band on the gel) if the individual carries the wild-type allele. On the other hand, the fwd-snp primer will produce a PCR product if the individual carries the SNP allele. Individuals who are homozygous wild-type will only have a band with the fwd-wt primer. Individuals who are homozygous for the SNP will only have a band with the fwd-snp allele. Heterozygous individuals will have a band with both primers. In the gel shown in the question, only individual III has a band with only the fwd-snp primer, so is homozygous for the SNP.

Question 47

The coding sequence of the KRAS gene within the genomic DNA of a colon cancer tumor was sequenced, yielding the below sequencing chromatogram. A point mutation of a wild-type Guanine base is observed in the sequence. Assuming the first three bases of the sequence form the first codon, use the genetic code to classify the mutation. A. Nonstop B. Silent C. Frameshift D. Missence E. Nonsence

Answer 47

D. Missence

Question 48

The image below shows the results of a gel-electrophoretic separation of a DNA sequencing reaction. What was the sequence of the strand being extended by the sequencing primer? ## Footnote A. 5'-ATGACCGTA-3' B. 5'-ATGCCAGTA-3' C. 3'-TACTGGCAT-5' D. 5'-TACTGGCAT-3' E. 5'-TACGGTCAT-3'

Answer 48

B. 5'-ATGCCAGTA-3' ## Footnote Well done! Pay close attention to the 5' to 3' directionality of the answer choices! To read the sequence of a sequencing gel, start at the bottom and read up. This gives you the sequence of the strand being synthesized in the 5' to 3' direction (remember the strand being synthesized is labeled, so that is what you see on the gel). This question asks for the sequence of the strand being extended by the primer - in other words, the strand being synthesized. So, you just read the sequence directly - no need to take the complementary sequence or change direction.

Question 49

The image below shows an individual being investigated for a disorder called Smith Magenis syndrome (SMS) caused by a microdeletion on Chromosome 17 at 17p11.2. The probe set used in this test includes two probes: 1) A red-labelled probe specific for the SMS region; and 2) a green-labelled probe used as an internal control for Chromosome 17. The result of this FISH analysis would be identified as: ## Footnote A. The patient does not have Smith Magenis syndrome (SMS) B. A karyotype should be ordered to confirm the diagnosis of Smith Magenis syndrome (SMS) C. There is no deletion of the SMS region on either one of the chromosome 17's D. The patient has only one chromosome 17 E. The patient has a chromosome 17 with a SMS region deletion

Answer 49

E. The patient has a chromosome 17 with a SMS region detection. Great! In the FISH assay the green probe is the control which labels chromosome 17. In the result we see 2 chromosomes with green labels – so these are the 2 copies of chromosome 17. The red probe labels the SMS critical region, and in the results we see it on only one copy of chromosome 17. This indicates that the copy of chromosome 17 without the red label has a deletion in the SMS region.

Question 50

A newborn infant presents with what you suspect is trisomy 9. The cytogenetics lab is overwhelmed, so you decide to attempt a DNA-based diagnosis. Using a probe specific for the XTY gene carried on chromosome 9 you obtain the following Southern Blot data. (The DNA analyzed in each well corresponds to the person in the pedigree shown directly above it. In other words, father, mother, and child are analyzed in lanes 1, 2, and 3, respectively.) Based on the data shown, in which parent and meiotic division did non-disjunction occur? A. Maternal Meiosis I B. paternal meiosis I C. Paternal meiosis II D. Maternal Meiosis II

Answer 50

D. Maternal Meiosis II Good pick. Southern blotting of a specific allele that is present on different homologs allows you to track both homologous chromosomes from all subjects on the same southern blot. It is routinely used by geneticists when screening a family for inheritance patterns. It is a valuable supplement to a pedigree bases on symptoms.

Question 51

Recall the procedure for making a double-stranded cDNA copy of an mRNA. Which of these is the second step in the process? A. Use Reverse Transcriptase to mak e acomplementary anti-sense DNA strand B. Hybridize the mRNA to a poly(T)-primer C. Use DNA Polymerase I to make a complementary anti-sense DNA strand D. Use RNase H to degrade the RNA E. Ligate the sticky ends into a similarly cut cloning vector

Answer 51

A. Use reverse transcriptase to mark a acomplementary anti-sense DNA strand. Great. Reverse transcriptase is an RNA-dependent DNA polymerase, and it shares the need for a 3'-OH to use as primer. Once an oligo-(dT) primer has annealed the poly-(A)-tail of the mRNAs, then the enzyme will rapidly make a single-stranded DNA complementary to the RNA sequence. Using this method with a collection of all the mRNAs expressed in a cell or tissue will enable someone to make a relatively permanent copy of the sequences expressed

Question 52

"Molecular hybridization" has major importance in modern DNA biotechnology. Many of the gene-chip or bio-chip machines depend on this basic principle to generate their catalogs of data. What very basic feature of double-stranded DNA structure is being exploited when conducting a molecular hybridization assay? A. the 5' to 3' polarity of a nucleic acid B. complementary base-pairing: single stranded DNA will recognize and bind by hydrogen-bond formation to the correct sequence of complementary bases on a different single-strand of DNA C. all DNA polymerases require an exposed 3' OH to use as a primer D.the stacking of aromatic bases stabilize the DNA duplex

Answer 52

B. complementary base-pairing: single stranded DNA will recognize and bind by hydrogen-bond formation to the correct sequence of complementary bases on a different single-strand of DNA Complementary base-pairing will allow one piece of single-stranded DNA to search out and bind its complementary sequence from among thousands or millions of non-complementary base sequences. The probe finds its target.

Question 53

What is most likely to bind to a regulatory element in an enhancer? A. The CAP protein B. TBP C. Any basal transcription factor D. A Repressor E. An Activator.

Answer 53

E. An activator. Correct. Enhancers act to increase rates of transcription so will be bound by activator transcription factors.

Question 54

If Iron (Fe2+) levels are high in a cell, what will happen regarding the expression of the transferrin receptor gene? A. The mRNA will be degraded. B. Heterochromatin formation will prevent gene expression C. Chromatin remodeling will activate gene expression D. Translation of the mRNA will be blocked. E. EIF2 will be degraded preventing translation. F. IREBP will bind an Iron Response Element in a silencer and recruit a corepressor. G. IREBP will bind an iron Response Element in an enhancer and recruit a coactivator.

Answer 54

A. The mRNA will be degraded. Good. The transferrin receptor is needed to import iron into a cell, so high intracellular iron argues against importing more iron and expression of the transferrin receptor will rapidly be repressed. Iron regulates the expression of the transferrin receptor post-transcriptionally. The Iron Response Element (IRE) is in the 3'UTR of the mRNA. When iron is high, the iron will bind to the IREBP protein which will dissociate from the IRE in the mRNA. This exposes RNA degradation signals in the mRNA sequence and the mRNA is rapidly degraded.

Question 55

A laboratory culture of E. coli is grown in a broth containing lactose as the only source of energy. The E. coli undergo exponential growth until eventually the lactose is depleted. Upon depletion of the lactose, what would happen regarding the regulation of the Lac Operon? A. The Repressor would dissociate from the Operator B. Allolactose levels would increase causing a decrease in transcription rates C. The Repressor would dissociate from the CAP site D. cAMP levels would decrease causing the CAP protein to bind to the promoter E. Allolactose levels would decrease causing a decrease in transcription rates F. cAMP levels would increase causing the CAP protein to bind to the promoter

Answer 55

E. Allolactose levels would decrease causing a decrease in transcription rates Great! If E. coli are growing in an environment where lactose is available but glucose is not, the Lac Operon will be expressed. cAMP will be produced. As the coactivator, cAMP will bind to the CAP protein and the CAP-cAMP complex will bind the CAP site and activate expression. At the same time, lactose will be converted to allolactose. The allolactose, as the inducer, will bind to the Repressor and prevent the Repressor from binding to the Operator - thus allowing activation to occur. When the lactose is depleted the allolactose levels will fall. The Repressor, no longer bound to allolatcose, will now bind to the Operator and repress expression.

Question 56

What mediates the interaction between an activator and a basal transcription factor? A. MutH B. A cis-coactivator C. a coactivator D. an RNA polymerase E. a trans-acting factor F. a histone deacetylase G. XPC

Answer 56

C. A coactivator. Great! Activators are a type of specific transcription factor that increase the rates of transcription. Activators do not directly recruit the RNA polymerase but instead act indirectly. If the activator binds nearby in the promoter it may act by directly recruiting the basal transcription factors, or if it binds further away, like in an enhancer, it will act through a mediator or "Bridge". A mediator of an Activator is called a coactivator.

Question 57

A human disorder that develops from chronic over-expression of a gene has now been mapped to a mutation in a locus located on a completely different chromosome. Which one of these answers is the best potential explanation for this problem? The mutation causes... ## Footnote A. loss-of-function of an activator B. loss-of-function of a repressor C. gain-of-function of a histone deacetylase D. gain-of-function of a DNA methylase E. loss-of-function of a histone acetyltransferase

Answer 57

B. Loss-of-function of a repressor. Good. Loss-of-function of a repressor transcription factor would be expected to Since the mutation is on a different chromosome it must be in a different gene which in some way affects the expression of the over-expressed gene. There are many ways this could happen, for example the mutated gene could be a transcription factor, or a regulator of chromatin structure. Of the answer choices, the only one which would result in over-expression of a gene (at least directly) is loss-of-function of a repressor.

Question 58

In E. coli, cAMP is a ligand for the CAP transcription factor. The CAP protein can only bind DNA when complexed with the cAMP ligand. What is the term used to describe this type of ligand? A. Coactivator B. Coinducer C. Repressor D. Corepressor E. Inducer

Answer 58

A. Coactivator Yes! A coactivator is a ligand that enhances the activity of an activator. Good. cAMP is a Coactivator because it enhances the activitiy of CAP, an activator. Note this is a term used in prokaryotes and is quite different from a Coactivator in eukaryotic systems.

Question 59

In human teratocarcinoma cells the R-Ras oncogene is upregulated. To begin to understand how the R-Ras gene is regulated, researchers cloned the R-Ras promoter upstream of the luciferase gene in a reporter plasmid. Using a sequence analysis they identified three putative regulatory elements, labelled A-C in the figure. They then generated mutations in each element. Mutations are indicated with a red X in the figure. What type of regulatory element is C? It is a/an... A. coactivator B. Trans-acting factor C. Corepressor D. Negative regulatory element E. TATA box. F. Positive regulatory Element.

Answer 59

F. Positive regulatory Element. Great! When element C was mutated, the gene expression dropped to about 10% of the wild-type-levels. That element must have been a positive (or activating) regulatory element.

Question 60

After testosterone binds to the androgen receptor, the receptor will bind to androgen response elements in testosterone-responsive genes. What type of DNA-binding domain does the androgen receptor use to make sequence-specific bonds with the DNA? A. Leucine Zipper B. Homeodomain C. Zinc Finger Domain. D. Helix-Turn-Helix. E. The ligand binding domain

Answer 60

C. Zinc Finger Domain. Great! Zinc finger domains are the type of DNA-binding domain found in all members of the nuclear receptor superfamily, including the steroid receptors.

Question 61

Which of the following is the best match for molecule X in the diagram (the RED oval) A. Cortisol B. Testosterone C. Thyroid hormone D. cAMP E. Glucocorticoid receptor F. CAP protein

Answer 61

E. Glucocorticoid receptor Great! In the figure we can see that molecule X binds to a heat-shock protein (chaperone) HSP. After it binds its ligand it forms a dimer, translocates to the nucleus, binds a response element, then activates transcription. So, molecule X is acting like a typical steroid-receptor. The glucocorticoid receptor is the only steroid receptor among the answer choices.

Question 62

After having had 2 pregnancies end in miscarriage, a husband and wife are referred for karyotype analysis. The analysis reveals that the wife’s karyotype is 46,XX, while the husband is 45,XY,rob(21q21q). They should be advised that if they were to conceive again, the probabilities that the embryo would be miscarried, develop into a normal child, or develop into a child with down syndrome are: A. 25% Miscarriage; 25% normal; 50% Down syndrome B. 50% misscarrieage; 0% normal; 50% Down Syndrome C. 50% miscarriage; 25% normal; 25% Down Syndrome D. 33% miscarriage; 33% normal; 33% Down Syndrome

Answer 62

B. 50% miscarriage; 0% normal; 50% Down Syndrome Very good. If a parent carries a 21q21q Robertsonian translocation, any conceptus generated from fertilization will be either monosomic for chromosome 21 (which results in miscarriage) or trisomic for chromosome 21 (which results in Downs Syndrome. Thus, it is not possible for this couple to produce a normal child.

Question 63

The karyotype shown below was most likely obtained from a..... A. Female with infertility B. Spontanously aborted fetus. C. Tall female with mild intellectual disability. D. 45,X Turner Syndrom patient. E. 45,X/46,XX Turner syndrom patient.

Answer 63

B. Spontanously aborted fetus. This karyotype definitely shows dramatic aneuploidy. With so many numerical abnormalities the embryo would not be viable.

Question 64

A couple have a 2 year old son with multiple congenital abnormalities who has been slow to reach developmental milestones. Karyotype analysis of all three family member identified structural abnormalities involving chromosome 3 (red) and 17 (blue) as shown in the diagram. Which of the following chromosomal segregations, in the parents, resulted in the unbalanced karyotype possessed by the son? ## Footnote A.Adjacent Segregation in Maternal Meiosis I B. Alternate Segregation in Paternal Meiosis II C. Adjacent Segregation in Paternal Meiosis II D. Adjacent Segregation in Maternal Meiosis II E. Alternate Segregation in Paternal Meiosis I F. Adjacent Segregation in Paternal Meiosis I G. Alternate Segregation in Maternal Meiosis II H. Alternate Segregation in Maternal Meiosis I

Answer 64

F. Adjacent Segregation in Paternal Meiosis I. ## Footnote Great! Since the father is carrying a balanced reciprocal translocation, it was his meiosis that resulted in the unbalanced karyotype in the son - so it is the paternal segregation. Segregation of homologues is always in Meiosis I (the quadrivalent involved will form in Prophase I of meiosis, at the same time a bivalent would normally form). Since the child is unbalanced, the segregation must have been Adjacent.

Question 65

A couple presents with unexplained infertility - four spontaneous abortions and no liveborn child in 5 years. During their infertility evaluation, you suggest that they have cytogenetic analysis to rule out chromosomal problems. Which sample would be most suitable for analysis? A. Neural Biopsy B. Adrenal Biopsy C. Amniotic Fluid D. Blood. E. Chorionic villus sample

Answer 65

D. Blood Great! A blood sample is most often used as a tissue source for genetic testing as obtaining blood is minimally invasive.

Question 66

What are the n and c numbers after Meiosis I completes, but before Meiosis II begins? A. n=1, c=4 B. n=2, c=2 C. n=1, c=2 D. n=2, c=4 E. n=1, c=1

Answer 66

C. n=1, c=2 Good answer! In G1 phase cells are diploid, with two copies of each chromosome, and each chromosome has 1 DNA double helix (n=2, c=2). In G2 phase, after DNA replication but before meiosis begins, there are still two copies of each chromosome (n=2) but they are now X-shaped, with each chromosome having two sister chromatid arms, so there are a total of 4 copies of the DNA double helix (c=4). In meiosis I the homologous pairs of chromosomes are segregated into two daughter cells, so when it completes, both the n and c number are divided in half (n=1, c=2). In meiosis II the sister chromatids of each chromosome are pulled apart (converting a single X-shaped chromosomes into 2 linear chromosomes) and the resulting chromosomes segregate into the gamates. The gamates are therefore n=1, c=1.

Question 67

Most children with Down syndrome are born to parents with normal genotypes in which a chromosome 21 meiotic nondisjunction occurred, resulting in trisomy 21. A small proportion of cases occur when one of the parents is a carrier of a Robertsonian translocation involving chromosome 21. A parent carrying a chromosome 21 Robertsonian translocation has a dramatically increased risk of having a child with Down syndrome compared to individuals with normal genotypes. For example, a known carrier of a 14q21q Robertsonian chromosome has a _____ theoretical chance of having a live-born child affected by Down syndrome. A. 100% B. 1% C. 33% D. 66% E. 10%

Answer 67

C. 33% If either parent carries a 14q21q chromosome, there is a 33% theoretical chance they will have a live-born child with Down syndrome. The actual empirical risk is lower than this, likely due to an increased frequency of miscarriage. If either parent carries a 21q21q chromosome there is a 100% chance that a live-born child will have Down syndrome. By contrast, the probability that two normal parents have a child with trisomy 21 depends upon the age of the mother. A mother aged 35 has a risk of ~1/400 of having a child with trisomy 21, while a mother aged 20 has a risk of ~1/1500.

Question 68

A 14-year old girl presents to a pediatrics clinic. Her mother is concerned that she has not yet begun menstruation. A physical exam show’s that she is small for her age, she is showing no signs of entering puberty and has minor webbing of the neck. Her karyotype is shown below. What is the most likely diagnosis? A. Turner Syndrome B. Klinefelter Syndrome C. XYY Syndrome D. Translocation Down Syndrome E. XXX Syndrome

Answer 68

A. Turner Syndrome. Great! Bothe the girl's presentation and her karyotype indicate Turener Syndrome.

Question 69

A newborn infant presents with what you suspect is trisomy 9. The cytogenetics lab is overwhelmed, so you decide to attempt a DNA-based diagnosis. Using a probe specific for the XTY gene carried on chromosome 9 you obtain the following Southern Blot data. (The DNA analyzed in each well corresponds to the person in the pedigree shown directly above it. In other words, father, mother, and child are analyzed in lanes 1, 2, and 3, respectively.) Based on the data shown, in which parent and meiotic division did non-disjunction occur? A. Paternal meiosis II B. Maternal Meiosis I C. Maternal Meiosis II D. Paternal Meiosis I

Answer 69

C. Maternal Meiosis II Good Pick. Southern blotting of a specific allele that is present on different homologs. allows you to track both homologous chromosomes from all subjects on the same southern blot.

Question 70

Below is a patient with Wolf-Hirschhorn Syndrome. Although she does not show the typical 'Greek helmet' facial appearance, she does have microcephaly, dysmorphic facies and mild mental retardation. Genetic analyses of this patient would reveal: A. Reciprocal translocation between chromosomes 9 and 22. B. Deletion of 4p 16 C. Robertsonian translocation betwwen chromosome 14 and 21 D. Deletion of 5p E. Paracentric inverstion in 4p.

Answer 70

B. Deletion of 4p 16 Great! Wolf-Hirschhorn Syndrome is caused by deletions in the p arm of chromosome 4. There is only one answer choice with deletions in this region of chromosome 4. The critical region is 4p 16.

Question 71

During your pediatrics rotation you observe a 3-week old female infant who died as a complication of congenital cardiac defects. The infant had microcephaly with a prominent occiput, rocker-bottom feet and displayed characteristic finger clenching prior to death. Her karyotype is shown below. You know that the non-disjunction which caused this condition most likely occurred in \_\_\_\_\_\_\_\_\_\_\_. A. Maternal meiosis I B. Paternal Meiosis I C. Paternal Meiosis II D. Maternal Meiosis II.

Answer 71

A. Maternal Meiosis I. Great! From the given information we do not know if which parent or stage of meiosis the nondisjunction occurred- so the best answer is the one which occurs most often; maternal Meiosis I.

Question 72

1. An enzyme, obtained from bacteria, which cleaves a phosphodiester bond between two specific nucleotides within a specific DNA sequence, is called a \_\_\_\_\_? 1. Restriction exonucleases 2. Zymogens 3. Restriction endonucleases 4. DNA glycosylase 5. Phosphodiesterase

Answer 72

C. Restriction endonucleases.

Question 73

The mutation that causes Sickle Cell Disease is \_\_\_\_\_\_\_? A. E6C in the HBA gene. B. E6C in the HBB gene. C. E6V in the HBA gene. D. E6V in the HBB gene.

Answer 73

D. E6V in the HBB gene.

Question 74

The following 6bp DNA-sequence (with blank spaces) represents a palindrome. What is the full sequence? 5'-A\_C\_C\_-3' A. ACCCCA B. ATCGGG C. TCGCGA D. AGCGCT E. TGGGGT

Answer 74

D. AGCGCT

Question 75

1. A single base pair DNA sequence variant, found in at least 1% of the population, is referred to as a/an… 1. Restriction site 2. Mutation 3. RFLP 4. Rare variant 5. SNP

Answer 75

E. SNP

Question 76

Rubinstein-Taybi (autosomal dominant) is characterized by intellectual disability, broad thumbs and toes, congenital heart defects, a characteristic facial appearance, and excessive hairiness. This example illustrates which genetic principle? A. Pleiotropy B. Variable expressivity. C. Genetic heterogeneity D. Reduced Penetrance. E. Complete Penetrance.

Answer 76

A. Pleiotropy

Question 77

When genotyping an individual by RFLP analysis using Southern Blotting, typically the target sample is \_\__i._\_\_\_\_ and the probe is \_\__ii._\_\_\_. A.i. A cDNA of a specific gene; ii. Genomic DNA B. i. Genomic DNA; ii. A cDNA of a specific gene C. i. Genomic DNA; ii. A cDNA of a specific gene D. i. All mRNAs from a specific cell type’ ii. A cDNA of a specific gene E. i. A cDNA of a specific gene; ii. An mRNA of a specific gene F. i. An mRNA of a specific gene; ii. Genomic DNA

Answer 77

C. i. Genomic DNA; ii. A cDNA of a specific gene.

Question 78

Shown is a map of a genomic region with BamHI restriction sites. There are two invariant sites at 0 and 10kb, and a polymorphic site at 4kb (indicated by the \*). If Southern blotting was performed using the probe indicated in red, what size band would be observed from the allele in which the polymorphic sites is absent? A. 10 kb B. 6 kb C. 4 kb D. A double-intensity band at 4kb. E. No band would be observed.

Answer 78

A. 10kb

Question 79

Which of the following conditions would increase the stringency of a DNA hybridization assay? 1. Addition of nuclease 2. Lower temperature 3. Lower concentration of urea 4. Lower salt concentration 5. Lower concentration of formamide

Answer 79

D. Lower salt concentration

Question 80

A 3-year old African American girl presents with severe abdominal pain, weakness, and dizziness. Physical examination reveals splenomegaly. A family history determined that both parents are relatively healthy, however, the father had once experienced a painful crisis after strenuous exercise. What condition is most likely affecting the father? A. Sickle-cell anemia B. Iron deficiency anemia C. Cystic fibrosis D. Huntington’s disease E. Sickle-cell trait

Answer 80

E. Sickle-cell trait.

Question 81

Which of the following types of mutations would NOT result in a restriction fragment length polymorphism? 1. A point mutation that destroys a restriction site 2. A point mutation that creates a restriction site 3. A 20bp insertion between two restriction sites 4. A 20bp deletion between two restriction sites 5. A 20bp inversion between two restriction sites

Answer 81

E. A 20bp inversion between two restriction sites

Question 82

The enzyme cuts the DNA at the position indicated by the arrow. Which of the following DNA ends is compatible with an end generated by BglII? A. A B. B. C. C D. D

Answer 82

A

Question 83

Shown at the top is an MstII restriction map of the HBB locus for both the wild-type and sickle cell mutant alleles. Below is the pedigree of a kindred in which the mutation is segregating. Southern blotting was performed on the family using the probe indicated in red. Which of the children are affected by sickle cell disease? 1. A 2. B 3. C 4. D 5. D 6. Both A and E 7. Both B and D

Answer 83

F. Both A and E

Question 84

What is the most common use of northern blotting? 1. Measuring the level of expression of specific genes in different tissues 2. Detecting RFLPs 3. Detecting SNPs 4. Measuring the amounts of a specific tRNA in different tissues 5. Measuring the amounts of a specific protein in different tissues

Answer 84

A. Meassuring the level of expression of specific genes in different tissues.

Question 85

A plasmid is… 1. An ionized gas 2. Single-stranded DNA 3. A viral vector 4. Capable of self-replication in a bacterial host 5. A type of flat-screen TN 6. About 10⁶ bp in size

Answer 85

D. Capable of self-replication in a bacterial host.

Question 86

The image shows a northern blot for the PSAT gene. Β-actin is a control. Which tissue has the strongest PSAT expression? A. Skeletal muscle B. heart C. Brain D. Testis E. Pancreas

Answer 86

E. Pancreas

Question 87

Total proteins are isolated from a muscle biopsy. The proteins are separated by SDS-PAGE and then blotted to a PVDF membrane. The dystrophin protein is then detected using a dystrophin-specific antibody. This technique is known as… 1. Southern blotting 2. Western blotting 3. Northern blotting 4. South-western blotting 5. Eastern blotting

Answer 87

B. Western Blotting

Question 88

A biotech company is developing a gene therapy for a disease in which they will overexpress a deficient gene. They want to test the therapy in a mouse model before beginning clinical trials in humans. They have cloned the gene into an expression vector and injected into a mouse ova. The treated ova are then implanted into a pseudopregnant female. After the foster mother gives birth the offspring are analyzed to assess the effect of the mutation. What are the offspring mice referred to as? 1. Cloned mice 2. Treated mice 3. Transgenic mice 4. Knock-out mice 5. Knock-in mice

Answer 88

C. Transgenic Mice

Question 89

You have isolated a novel human brain protein that plays a role in Parkinson’s disease. You have sequenced the protein, and inferred the coding sequence of a gene. You would like to obtain the coding sequence by screening a library. Which type of library is most appropriate to screen? 1. Genomic DNA BAC library 2. Genomic DNA viral library 3. Muscle cDNA plasmid library 4. Brain cDNA plasmid library 5. Muscle expression library

Answer 89

D. Brain cDNA plasmid library

Question 90

The mRNA and protein of a eukaryotic gene were analyzed by northern (N) and western (W) blotting. Wild type gene expression was compared to several mutants (A-E). which of the mutants is most likely a nonsense mutation? A. A B. B C. C D. D E. E

Answer 90

B. B

Question 91

Bacterial Artificial Chromosomes (BACs) are normally used for cloning which type of molecule? 1. Entire human chromosomes 2. cDNAs expressed in a specific cell type 3. Large fragments of genomic DNA 4. mRNA expressed in a specific cell type 5. All cDNAs expressed in an organism

Answer 91

C. Large fragments of genomic DNA.

Question 92

A gene mutation was analyzed by comparing the mutant gene’s mRNA and protein products to those of the wild-type gene using northern (N) and western (W) blotting. Based on the results, what is the most likely type of mutation? A. Missense conservative B. Nonsense C Frameshift D. Missense nonconservative E. Nonstop

Answer 92

E. Nonstop

Question 93

The Rodda Pharmaceutical Corporation LTD is studying top-secret gene X. they compared its expression in several tissues by northern blotting. Most tissues expressed the expected mRNA size, but heart and muscle expressed an aberrant form. What is the most likely explanation for the aberrant mRNA from gene ‘X’ in muscle? In muscle, for gene ‘X’ there is… A. Decreased gene expression B. Alternative splicing resulting in a large transcript C. Alternative splicing resulting in a smaller transcript D. A missense mutation E. A nonsense mutation

Answer 93

C. Alternative splicing Resulting in a smaller transcript

Question 94

You are cloning a DNA insert into the BamHI site of plasmid pRB322 as shown in the figure. How can you distinguish bacteria carrying the plasmid with the insert from the original plasmid without the insert?

Answer 94

Regulation of Prokaryotic Gene Expression

Question 95

Which step in the gene expression pathway is the most important? 1. Transcription initiation 2. Transcription elongation 3. mRNA processing 4. mRNA nuclear export 5. Translation initiation 6. Translation elongation 7. Protein post-translational modification

Answer 95

A. Transcription initiation

Question 96

Which of the following gene regulatory mechanisms is used by prokaryotes but not eukaryotes? 1. Epigenetic regulation 2. Initiation of transcription at proximal promoters 3. Coordinated gene regulation by operons 4. Trans-acting factors acting through cis-acting element 5. Control of transcription factors by ligands

Answer 96

C. Coodinated gene regulation by operons

Question 97

In the E.coli lac operon the operator is bound by the … 1. Repressor protein bound to the inducer 2. Repressor protein bound to the co-repressor 3. Repressor protein with no ligand 4. CAP protein bound to the repressor 5. CAP protein bound to the co-activator 6. CAP protein with no ligand

Answer 97

C. Repressor protein with no ligand.

Question 98

Which of the following is NOT a standard method for measuring the expression of a specific gene? 1. Northern blotting 2. Western blotting 3. Gene expression microarray 4. Quantitative reverse-transcriptase PCR (qRT-PCR or rtRT-PCR) 5. Next-generation sequencing (RNA-seq)

Answer 98

B. Western Blotting.

Question 99

In the regulation of the E.coli lac operon, the CAP protein only binds the CAP site when… 1. It is unliganded 2. It is bound to allolactose 3. There is glucose available 4. There is lactose available 5. It is bound to cAMP

Answer 99

E. It is bound to cAMP

Question 100

The regulatory region found in all genes, both prokaryotic and eukaryotic, located immediately upstream of the transcription start site, and comprised of smaller regulatory elements, is called a/an… 1. INR element 2. TATA box 3. Enhancer 4. Promoter 5. Start codon

Answer 100

D. Promoter

Question 101

A laboratory culture of E. coli is grown in a broth containing lactose as the only source of energy. The E. coli undergoes experimental growth until eventually the lactose is depleted. Upon depletion of the lactose, what would happen regarding the regulation of the Lac Operon? 1. The repressor would dissociate from the operator 2. The repressor would dissociate from the CAP site 3. cAMP levels would increase causing the CAP protein to bind to the promoter 4. cAMP levels would decrease causing the CAP protein to dissociate from the promoter 5. Allolactose levels would increase causing a decrease in transcription rates 6. Allolactose levels would decrease causing a decrease in transcription rates

Answer 101

F. Allolactose levels would decrease causing a decrease in the transcription rates.

Question 102

In prokaryotic systems, a ligand that binds to a transcription factor and then induces the transcription factor to bind DNA and activate transcription is referred to as a/an… 1. Inducer 2. Repressor 3. Co-activator 4. Co-repressor

Answer 102

C. Co-activator

Question 103

Which of the following is true of the Sigma factor? 1. It is required for transcription in both eukaryotes and prokaryotes 2. It is a component of the DNA polymerase 3. There is only a single type of sigma factor 4. It determines the strength of gene expression but not the specificity 5. It initiates transcription by binding the -10 and -35 boxes

Answer 103

E. It initiates transcription by binding the -10 and -35 boxes.

Question 104

A laboratory culture of E. coli is grown in a broth containing only lactose. While the E. coli are grown exponentially a solution of glucose is added to the culture. After the glucose is added, what would happen regarding the regulation of the Lac Operon? 1. The repressor would dissociate from the operator 2. The repressor would dissociate from the CAP site 3. cAMP levels would increase causing the CAP protein to bind to the promoter 4. cAMP levels would decrease causing the CAP protein to dissociate to the promoter 5. Allolactose levels would increase causing a decrease in transcription rates 6. Allolactose levels would decrease causing a decrease in transcription rates

Answer 104

D. cAMP levels would decrease causing the CAP protein to dissociate to the promoter

Question 105

In general, what is the effect of histone methylation on gene expression? 1. Neutral 2. Activating 3. Silencing→ DNA methylation 4. Variable

Answer 105

D. Variable

Question 106

Which of the following would occur in genomic regions which feature extensive deacetylation of histones? 1. 30nm fiber→ euchromatin 2. 10nm fiber→ euchromatin 3. Heterochromatin 4. DNA hypomethylation→ associated with gene activation 5. Strong HAT activity

Answer 106

C. Heterochromatin

Question 107

Which of the following is NOT a property if Swi/SNF family proteins? 1. Acetylation of histones 2. ATP hydrolysis 3. Remodeling chromatin 4. Removal of histones 5. Replacement of histones

Answer 107

A. Acetylation of histones

Question 108

The function of a barrier sequence is to… 1. Block the activity of an enhancer 2. Block the spreading of heterochromatin into regions of euchromatin 3. Inhibit gene expression 4. Activate gene expression 5. Block the spreading of euchromatin into regions of heterochromatin

Answer 108

C. Block the spreading of heterochromatin into regions of euchromatin

Question 109

CREB is an activator transcription factor. It is activated by phosphorylation by a kinase which in turn is activated by the second messenger cAMP. The DNA sequence elements that cREB binds to are called... 1. Negative regulatory elements 2. Insulator elements 3. Barrier sequences 4. cAMP response elements 5. Steroid response elements 6. Hormone response elements

Answer 109

D. cAMP response elements.

Question 110

To study the regulation of the BLM gene its prompter is cloned upstream of a luciferase report gene. Point mutations were generated in five putative regulatory elements. What type of regulatory element is C? A. Positive B. Barrier C. Negative D. Insulator E. Non-regulatory/neutral

Answer 110

C. Negative

Question 111

The SHH gene is expressed during embryogenesis in the developing brain and limbs. A regulatory region for the gene was found 1 million base-pairs upstream of the gene. The region activates SHH expression specifically in the limbs. When the region is cut out and moved 10kb downstream of the gene it still functioned properly. Thy type of element is called a/an… 1. Promoter 2. Insulator 3. Barrier 4. Silencer 5. Activator 6. Enhancer

Answer 111

F. Enhancer

Question 112

To study the regulation of the MLK gene, its promoter was cloned upstream of a luciferase reporter gene. A series of promoter deletions was generated. Which of the putative elements (A-E) is the strongest positive regulatory element? A. A B. B C. C D. D E. E

Answer 112

A.A

Question 113

What is the type of DNA-binding domain found in all members of the nuclear receptor superfamily (including the steroid hormone receptors)? 1. Leucine zipper 2. Zinc finger 3. Basic helix-loop-helix 4. Helix-turn0helix 5. HMB box

Answer 113

B. Zinc Finger

Question 114

Proteins which assist in transcriptional regulation by bridging specific transcription machinery, without making sequence-specific DNA contacts, are referred to as… 1. Trans-acting factor→ another way of saying transcription factor 2. Receptors 3. Antagonists 4. Mediators 5. Agonists

Answer 114

D. Mediators

Question 115

Tamoxifen is widely used to treat estrogen receptor-positive breast cancer. It has several side-effects, including increasing the risk of endometrial cancer, but generally, the benefits outweigh the risk. What is the hormonal action of tamoxifen in the breast and endometrium? A. A B. B C. C D. D

Answer 115

A

Question 116

The figure shows a signal transduction machinist for a ligand-regulated transcription factor. What are the identities of the ligand and transcription factor? 1. cAMP and CREB 2. Allolactose and the lac repressor 3. Steroid hormone and steroid hormone receptor 4. cAMP and the CAP protein 5. Growth factor and growth factor receptor

Answer 116

C. Steroid hormone and steroid hormone receptor

Question 117

In this diagram of a transcription initiation complex, which of the arrows is pointing at a specific transcription factor? 1. A→ co-activator 2. B→ RNA polymerase 3. C→ general transcription factor(s) 4. D→ enhancer element 5. E→ specific transcription factor

Answer 117

E→ specific transcription factor

Question 118

Transcription factors must bind to specific DNA sequences in order to regulate gene expression. To which part of the DNA molecule do they bond with, in order to recognize specific sequences? 1. 1’ carbon of the ribose 2. Glycosidic bond 3. 2’ carbon of the ribose 4. Phosphodiester group 5. Nitrogenous bases

Answer 118

E. Nitrogenous bases

Question 119

The ApoB proteins play critical roles in the transport of cholesterol and triglycerides through the circulatory system. There are two variants of apoB: ApoB100 (100% size) is produced in the liver, while ApoB48 (48% size) is produced in the intestine. Both variants are produced by the same gene. What mechanism results in the smaller size protein produced in the liver? 1. Alternative splicing 2. Proteolytic cleavage 3. Gene shuffling 4. RNA editing 5. Recombination

Answer 119

D. RNA editing

Question 120

When iron (Fe²⁺) is low in a cell, what happens to the translation of the Transferrin Receptor? 1. IREBP binds the 5’ end of the mRNA and blocks the ribosome 2. IREBP dissociates from the 5’ end of the mRNA allowing translation 3. IREBP binds the 3’ end of the mRNA, stabilizing the mRNA and allowing translation 4. IREBP dissociates from the 3’ end of the mRNA causing the mRNA to be degraded

Answer 120

C. IREBP binds the 3' end of the mRNA, stabilizing hte mRNA and allowing translation.

Question 121

How many cells are found in a human organism? 1. About 1 million 2. About 100 million 3. About 300 billion 4. About 100 trillion 5. It is impossible to estimate

Answer 121

D. About 100 trillion

Question 122

Which of the following is present in BOTH, prokaryotes and eukaryotes? 1. Cell membrane 2. Nucleus 3. Cell Wall 1. Only I is correct 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, and III) are correct

Answer 122

a. Only I is correct.

Question 123

Which of the following is the *_least likely_* component of a human cell membrane? 1. Cholesterol 2. Transmembrane glycoprotein 3. Peptidoglycan 4. Phosphatidylcholine

Answer 123

C. Peptidoglycan

Question 124

Glycosylphosphatidylinositol is… 1. A transmembrane protein that covalently binds proteins to the inner leaflet 2. A glycolipid involved in signaling and attaches noncovalently to extracellular proteins 3. A glycolipid that covalently anchors peripheral proteins to outer leaflet

Answer 124

C. A glycolipd that covalently anchors peripheral proteins to outer leaflet.

Question 125

Which of the following increases membrane fluidity? 1. Unsaturated fatty acid tails 2. Shorter chain fatty acids 3. Increased temperature 1. Only I is correct 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, and III) are correct

Answer 125

e. All of the above (I, II, and III) are correct.

Question 126

A patient with alcoholic cirrhosis who shows ascites, an umbilical hernia, and wasting of muscles. His blood work shows an increased reticulocyte count. You also find a distorted cholesterol balance in the plasma and RBC membrane, with excess cholesterol present in the RBC membrane. You expect to find ALL of the following in your alcoholic patient, _EXCEPT_: 1. Spur cells 2. Acanthocytosis 3. Spherocytosis 4. Hemolytic anemia 5. Sequestration and destruction of RBCs by the spleen

Answer 126

C. Spherocytosis

Question 127

The influenza virus utilizes lipid rafts in the plasma membrane for viral assembly and budding. What component of lipid rafts would be useful for structural support in the viral envelope? 1. G(M1) ganglioside 2. Cholesterol 3. Spectrin 4. Glycocalyx 5. Nucleoporin

Answer 127

B. Cholesterol

Question 128

The surface antigens of an unknown pathogen are negatively charged. The cell membranes of the patient’s cells are also negatively charged, so the pathogen is repelled from the cells. What structures are responsible for the overall negative charge on the outer cell membrane of healthy cells? 1. Peripheral proteins expressing serine 2. Bilayer fatty acid chains 3. Phosphatidylserine 4. Sialic acid sugars

Answer 128

D. Sialic acid Sugars

Question 129

As a scientist, you developed a new drug that specifically blocks the extracellular portion of transmembrane protein transporters. Which of the following processes do you expect to be affected? 1. Uptake of glucose into the cell 2. Binding of the cell to ECM 3. Signal transduction of G-coupled receptors 1. Only I is correct 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, and III) are correct

Answer 129

A. Only I is correct.

Question 130

Membranes of cells and organelles allow certain types of molecules to pass through but not others. This selectivity is due to the construction of cellular membranes. Cell membranes are made of a lipid bilayer of hydrophobic molecules. The easiest way to visualize this is to imagine pouring vegetable oil into a glass partially filled with water. The vegetable oil which is hydrophobic will float on top of the water. In this model, hydrophobic molecules of cell membrane resemble vegetable oil and repel water. Which type of molecule will pass MOST easily through the membrane of a cell or organelle? 1. Small and hydrophilic 2. Small and hydrophobic 3. Large and hydrophilic 4. Large and hydrophobic

Answer 130

B. Small and Hydrophobic

Question 131

Plasmapheresis is a process in which the liquid part of the blood, or plasma, is separated from the blood cells. Typically, the plasma is replaced with another solution such as saline or albumin, or the plasma is treated and then returned to your body. Liver transplantation or hepatic transplantation is the replacement of a diseased liver with the healthy liver from another person (allograft). Both plasmapheresis and liver transplantation have been reported as a successful treatment for… 1. Acanthocytosis 2. Hereditary spherocytosis 3. Cholera 4. Both A and B are correct 5. All of the above (A, B, and C) are correct

Answer 131

A. Acanthocytosis

Question 132

Which of the following is present in BOTH, prokaryotes and eukaryotes? 1. Cell membrane 2. Nucleus 3. Cell Wall 1. Only I is correct 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, III) are correct

Answer 132

a. Only I is correct.

Question 133

During nuclear import through NPC, what is the role of Ran-GTP? 1. To bind the NLS and mediate transport into the NPC 2. To interact with importin, dissociating cargo complex 3. To release importin into the cytoplasm

Answer 133

1. To interact with importin, dissociating cargo complex 2. To release importin into the cytoplasm

Question 134

Epithelial cells of the inner lining of the gut have a high mitotic index. These cells are constantly replicating DNA, transcribing mRNA, and translating protein. During prophase of mitosis, what happens to the nuclear lamina? 1. CDK1 dephosphorylates nuclear lamina, so it disassembles 2. nuclear lamina disassembles and Lamin A is bound to the inner membrane of nuclear envelope vesicles 3. Lamina A & C are released as free dimers when nuclear lamina disassembles 4. Inactivation of CDK1 allows for lamina to be phosphorylated, so it reassembles

Answer 134

C. Lamina A & C are released as free dimers when nuclear lamina disassembles

Question 135

A 20-month old boy is diagnosed with Hutchinson-Gilford Progerial Syndrome. Fetal and early postnatal development are normal, but there is now a severe failure to thrive. His neurological and cognitive tests are normal. Genetic analysis shows a single spontaneous mutation in code 608 of the LMNA gene, which encodes both lamin A and C. Which one of the following would you most likely expect to be direct effect in cells obtained from this patient? 1. Increased heterochromatin 2. Interference with microtubule treadmilling 3. Loss of ability to adhere to the basement membrane through integrins 4. Aberrations in nuclear architecture

Answer 135

D. Aberrations in nuclear architecture

Question 136

Therapeutic use of a cyclin-dependent kinase 1 (CDK1) inhibitor as an anti-cancer medication would most likely inhibit which of the following cellular processes? 1. Emerin synthesis 2. Lamin B attachment to the inner nuclear membrane 3. Lamin phosphorylation 4. Ran GAP hydrolysis

Answer 136

C. Lamin phosphorylation

Question 137

What type of macromolecules are imported into the nucleus? 1. Histones and polymerases 2. Ribosomes 3. tRNA and mRNA 1. Only I is correct 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, III) are correct

Answer 137

A. Only I is correct

Question 138

1. An 8-month old infant presents to the clinic for a routine check-up. The parents note that the child has not met his normal developmental milestones and is suddenly having difficulty feeding. The physician notices that the patient is hypotonic, is experiencing dysphagia, and has muscular atrophy. The physician decides to order a DNA test and it tests positive for a mutation in the SMN gene. What is the major cause of this disease and what will be the result of it? 1. Defective snRNP assembly and pre-mRNA splicing leading to loss of motor neurons 2. Altered lamin A leading to the unstable nuclear envelope and progressive nuclear damage 3. Lamin A& C defect leading to peripheral lipoatrophy with muscle prominence

Answer 138

A. Defective snRNP assembly and pre-mRNA splicing leading to loss of motor neurons

Question 139

Which of the following is correctly matched? 1. Speckle :: mRNA modification 2. Nucleolus :: mRNA synthesis 3. Cajal bodies and gems :: ribosome factory 1. Only I is correct 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, III) are correct

Answer 139

a. Only I is correct

Question 140

1. Which of the following is/are correct? The nucleolus is formed… 1. … around nucleolar organizer regions (NORs) 2. … around clusters of rRNA gene repeats 3. … for the synthesis of rRNA and assembly of ribosomes 1. Only I is correct 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, III) are correct

Answer 140

e. All of the above (I, II, III) are correct

Question 141

1. Which of the following is correctly matched? 1. sER :: lipid synthesis 2. Nucleolus :: mRNA synthesis 3. rER :: ribosome synthesis 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, III) are correct

Answer 141

a. Only I

Question 142

1. When the body is sleeping, our brain still needs glucose. The liver plays a role in making glucose readily available. Which statement is _correct_ regarding this process? 1. sER glucose-6-phosphatase dephosphorylates G6P to produce free glucose 2. Glucose is converted to G6P to be transported from the cells 3. Glucose-6-phosphatase phosphorylates G6P to make free glucose 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, III) are correct

Answer 142

a. Only I

Question 143

1. You could be considered “the angel of death”... 1. Poly-ubiquitination 2. The proteasome 3. Chaperone PiP (Binding Protein) 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above (I, II, III) are correct

Answer 143

b. Both I and II

Question 144

Angelman Syndrome (AS) is a complex genetic disorder that arises due to ineffective targeting of misfolded proteins for degradation. AS is characterized by severe developmental delays, speech impairment, and a unique happy demeanor associated with excessive laughing, smiling, and excitability. Microcephaly and epilepsy is also common in patients with AS. the specific gene lacking in AS patients aids in regulating protein synthesis and degradation at nerve cell junctions (synapses). An absence of this gene will impair synaptic plasticity, and therefore, learning and memory, by resulting in a deficiency of a particular enzyme that attaches a particular molecule to a protein requiring degradation. Given this information, what enzyme is deficient in AS patients? 1. Glucose-6-phosphatase 2. Catalase 3. Ubiquitin protein ligase 4. Tyrosine protein kinase 5. Protein kinase A (PKA)

Answer 144

c. Ubiquitin protein ligase

Question 145

Which of the following terms is _least_ associated with the rough endoplasmic reticulum (rER)? 1. Plasma membrane proteins 2. Cotranslational translocation 3. BiP chaperone 4. Lipoprotein production 5. N-linked glycosylation

Answer 145

d. Lipoprotein production

Question 146

When describing the process of protein synthesis in the rER, place the following in the correct order 1. BiP binds peptide 2. Signal recognition particle binds to ER signal sequence 3. SRP complex brings the ribosome to a translocon 4. N-linked glycosylation 1. I, I, IV, III 2. II, I, III, IV 3. IV, II, III, I 4. I, II, III, IV 5. IV, I, II, III 6. IV, II, I, III 7. I, IV, III, II 8. None of the above

Answer 146

h. None of the above

Question 147

1. From a molecular biology perspective, what is the cause of cystic fibrosis? 1. Improper clathrin-pit formation 2. Defective cotranslational translocation 3. Incorrect protein folding 4. Excessive N-linked glycosylation

Answer 147

c. Incorrect protein folding

Question 148

1. Ribophorins/SRP receptors are required for 1. Synthesis of ribosomes in the nucleus 2. Attachment of the ribosome to the rER 3. Attachment of ribosomes to mRNA 4. A and B are correct 5. B and C are correct

Answer 148

b. Attachment of the ribosome to the rER

Question 149

When describing ‘tag’ versus ‘destination’ which of the following is correctly matched? 1. KDEL→ ER 2. KKXX→ ER 3. M6P→ lysosome 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above are correct

Answer 149

e. All of the above are correct

Question 150

During the process of protein synthesis, what processes happen n both, the lumen of the rER and the lumen o the Golgi? 1. Glycosylation 2. Folding 3. Tagging with mannose-6-phosphate 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above are correct

Answer 150

a. Only I

Question 151

Protein X is a membrane protein that transports protein Y from the rER to the Golgi. Protein X is synthesized in the \_\_\_\_\_\_\_, and contains a ______ tag. It moves into a _______ vesicle and brings protein Y to the Golgi. After the release of its cargo, it returns to the rER via \_\_\_\_\_\_\_\_\_. 1. Lumen of ER, M6P, COPI, COPII 2. Lumen of ER, KDEL, COPII, COPII 3. Lumen of ER, KKXX, COPII, COPI 4. Cytosol , M6P, COPII, COPI 5. Cytosol, KDEL, COPI, COPII

Answer 151

c. Lumen of ER, KKXX, COPII, COPI

Question 152

When describing the secretory pathway between rER and Golgi, which of the following statements is correct? 1. The forward secretory pathway, from rER to Golgi involves coatomer I (COPI) coated vesicles 2. Vesicle docking is facilitated by Rab- GTP and the tethering protection Rab effector 3. Vesicles synthesized in the rER first encounter the trans face of the Golgi (TGN) and travel through cisternae until reaching the cis face of the Golgi (CGN) 4. v-SNARES and t-SNARES are essential for both vesicle formation and budding (“pinching off”)

Answer 152

b. Vesicle docking is facilitated by Rab- GTP and the tethering protection Rab effector

Question 153

Familial hypercholesterolemia is a disorder that is passed down through families. It causes LDL (bad) cholesterol levels to be very high. The condition begins at birth and can cause heart attacks at an early age. At the molecular level, there are 5 types of this disorder. When considering Class II, what are the molecular basis of the defect? 1. Lack of binding to the receptor in the rER, never forming (COPI) coated vesicle 2. Improper folding, causing degradation in the proteasome 3. Defective transport from the rER, never reaching the plasma membrane 4. None of the above

Answer 153

c. Defective transport from the rER, never reaching the plasma membrane

Question 154

When describing vesicle creation of coatomer (COP) coated vesicles, what is the correct order of events? 1. Receptors concentrated in the membrane 2. Cargo receptors bind “cargo proteins” 3. Vesicle buds and pinches off 4. Coat proteins fall off, exposing SNAREs 1. I, II, IV, III 2. II, I, III, IV 3. IV, II, III, I 4. I, II, III, IV 5. IV, I, II, III 6. IV, II, I, III 7. I, IV, III, II 8. None of the above

Answer 154

b. II, I, III, IV

Question 155

Which of the following described I Cell Disease? 1. Deficiency of N-acetylglucosamine phosphotransferase 2. Absence of M6P tag 3. A defect during the processing in the golgi 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above are correct

Answer 155

E. All of the above are correct

Question 156

You walk into the ER and encounter a peculiar patient. The patient complains of neck stiffness, dysphagia, and lockjaw. The patient states that they stepped on a rusty nail, but thought nothing of it. Chances are this patient was exposed to the _______ toxin, which degraded\_\_\_\_\_\_\_\_. 1. Tetanus / synaptobrevin 2. Tetanus / syntaxin 3. Botulin / synaptobrevin 4. Botulin / syntaxin

Answer 156

a. Tetanus/Synaptobrevin

Question 157

Secretion of the Golgi to the extracellular compartment can take place via Constitutive vs. Regulated Secretion. Which of the following secretions do you expect to use the regulated mechanism? 1. Insulin release from pancreatic cells 2. Secretion of ECM components by fibroblasts 3. Release of digestive enzymes in the GI tract 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 157

c. Both I and III

Question 158

Borna disease virus (BDV) exhibits high neurotropism and provides an important and unique experimental model system for studying virus-cell interactions within the central nervous system. BDV surface glycoprotein (G) plays a critical role in virus cell entry receptor-mediated endocytosis, and therefore, G is a critical determinant of virus tissue and cell tropism. As a scientist, you are developing a drug to combat this illness. Which of the following strategies represents a possible effective approach? The drug acts by… 1. Blocking ubiquitin tagging of the virus G protein 2. Interfering with the M6P receptor binding in the Golgi 3. Preventing the formation of clathrin coats 4. Inhibiting pinocytosis

Answer 158

c. Preventing the formation of clathrin coats.

Question 159

The Adaptins (AP complex) proteins in Clathrin-coated pits are most analogous to… 1. Signal recognition (SRP) & SRP receptor on the ER 2. Sec23/24 COPII coat proteins 3. Nuclear importin & exportin 4. Ubiquitin & proteosome

Answer 159

b. Sec23/24 COPII coat proteins

Question 160

When describing endocytosis clathrin-coated vesicle formation, what is the correct order of events? 1. AP (adaptins) recruitment 2. Clathrin assembly (invagination) 3. Uncoating of clathrin & adaptin 4. Vesicle budding (dynamin GTPase) 1. I, II, IV, III 2. II, I, III, IV 3. IV, II, III, I 4. I, II, III, IV 5. IV, I, II, III 6. IV, II, I, III 7. I, IV, III, II 8. None of the above

Answer 160

a. I, II, IV, III

Question 162

Familial hypercholesterolemia is a disorder that is passed down through families. It causes LDL (bad) cholesterol levels to be very high. The condition begins at birth and can cause heart attacks at an early age. At the molecular level, there are 5 types of this disorder. When considering Class IV, what are the molecular of the defect? 1. Lack of binding to the receptor in the rER, never forming (COPI) coated vesicles 2. Improper folding, causing degradation in the proteasome 3. Defective transport from rER, never reaching the plasma membrane 4. None of the above

Answer 162

d. None of the above

Question 163

When describing the phases of phagocytosis, what is the correct order of events? 1. Acidic hydrolases degrade ingested material 2. Phagocytic cup formed around foreigner 3. Formation of phagolysosome 4. Phagocyte binding to opsonins 1. I, II, IV, III 2. II, I, III, IV 3. IV, II, III, I 4. I, II, III, IV 5. IV, I, II, III 6. IV, II, I, III 7. I, IV, III, II 8. None of the above

Answer 163

c. IV, II, III, I

Question 164

Which of the following applies to “pinocytosis”? 1. Defined as “cell drinking” 2. Also known as “phagocytosis” 3. Involves clathrin-coated pits 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 164

a. Only I

Question 165

When contrasting the mechanism of action between botulin and tetanus toxins, which of the following statements applies to both? 1. Cleaving of synaptobrevin (v-SNARE) 2. Prevent vesicle fusion 3. Prevent dissociation of synaptobrevin from syntaxin 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 165

b. Both I and II

Question 166

Which of the following is correctly matched? 1. sER :: Lipid synthesis 2. Nucleolus :: mRNA synthesis 3. Lysosomes :: oxidative phosphorylation 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 166

a. Only I

Question 167

You could be considered “The Angel of Death” (and/or “Hitman” if you prefer…) 1. Poly-ubiquitination 2. The proteasome 3. The lysosome 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 167

e. All of the above

Question 168

Who do acid hydrolases reach the inside of the lysosome? 1. The M6P receptor protein binds a translocon on the lysosome surface 2. Proteins are translated directly into the lysosomal lumen by ribosomes attached to its surface 3. Lysosomal importin protein binds them as cargo and transfers them from cytosol to lysosomal lumen 4. Clathrin-coated vesicles derived from the Golgi merge with lysosomal or endosomal membranes

Answer 168

d. Clathrin-coated vesicles derived from the Golgi merge with lysosomal or endosomal membranes

Question 169

When describing endocytic clathrin-coated vesicle formation, what is the correct order of events? 1. Coated proteins disassemble, exposing Rab & SNAREs 2. Adaptins lin receptors to Clathrin coated proteins 3. Vesicle budding (dynamin GTPase) 4. Cargo receptors bind “M6P-tagging cargo proteins” in the lumen of Golgi 1. I, II, IV, III 2. II, I, III, IV 3. IV, II, III, I 4. I, II, III, IV 5. IV, I, II, III 6. IV, II, I, III 7. I, IV, III, II 8. None of the above

Answer 169

c. IV, II, III, I

Question 170

As a scientist, you were able to develop successful gene therapy replacement for the enzyme N-acetylglucosamine phosphotransferase. Which of the following lysosomal storage diseases do you expect to benefit from your discovery? 1. I-cell disease 2. Pseudo-Hurler Polydystrophy 3. Chediak- Higashi syndrome 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 170

B. Both I and II

Question 171

Which of the following is correctly matched? 1. Clathrin :: endocytosis (receptor-mediated) 2. Clathrin :: Golgi to lysosome/endosome 3. Clathrin :: Golgi to plasma membrane 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 171

b. Both I and II

Question 172

1. Which of the following is degraded inside the lysosome? 1. Engulfed bacteria 2. Aged organelles 3. Misfolded proteins 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 172

B. Both I and II

Question 173

Which of the following terms is/are associated with autophagy? 1. Old organelles 2. Fusion with a lysosome 3. Clathrin-coated 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 173

B. Both I and II

Question 174

How do we define mucopolysaccharidoses? 1. Defective degradation of GAGs 2. Defective degradation of sphingolipids 3. Absence of M6P tag 4. Accumulation of glycoprotein and glycolipid 5. Both A and C

Answer 174

a. Defective degradation of GAGs

Question 175

PTS1 is recognized using what motif? 1. Glu-Leu0Lys 2. Leu0Phe-Tyr 3. Ser-His-Leu 4. His-Gin-Trp 5. None of the above

Answer 175

e. None of the above.

Question 176

What enzyme found in the peroxisome degrades hydrogen peroxide? 1. Hydrogen peroxide convertase 2. Catalase 3. Degradase 4. Hydrogen peroxide oxidase 5. None of the above

Answer 176

B. Catalase

Question 177

A newborn was being evaluated in the Emergency Department due to seizures and severe hypotonia. The doctors suspect the child may have Zellweger syndrome, an autosomal recessive disorder. Which would be true if they are correct in the diagnosis? 1. Proteins don’t recognize SKL/PTS1 signals 2. VLCFA oxidation is abnormally increased 3. Failure to import peroxisomal enzymes 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 177

c. Both I and III.

Question 178

Peroxins in the peroxisome are analogous in the role to which of the following proteins? 1. Translocons in the ER membrane 2. Importins in the nucleus 3. Glycocalyx on plasma membrane 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 178

a. Only I

Question 179

1. Which of the following terms *_least_* associates with peroxisomes? 1. Xanthine oxidase 2. Catalase 3. Hydrolases 4. Beta-oxidation 5. Plasmalogen

Answer 179

C. Hydrolases.

Question 180

What is true about plasmalogen? 1. Phospholipid with hydrocarbon chain linked to glycerol by ether bond (not ester bond) 2. 80-90% of myelin membrane phospholipid 3. It is synthesized in the peroxisome 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 180

E. All of the above

Question 181

Allopurinol is… 1. Xanthine oxidase inhibitor 2. Catalase activator 3. A purine analog 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 181

A. Only I

Question 182

Nonalcoholic steatohepatitis ( NASH) is a form of fatty liver disease where benign hepatic steatosis leads to chronic inflammation in the steatotic liver of a patient without any history of alcohol abuse. Mechanisms underlying the progression of hepatic steatosis to NASH have long been investigated. Loss of peroxisomes as well as impaired peroxisomal functions has been demonstrated to occur in inflammatory conditions including NAS. Defects in which of the following peroxisomal processes would most likely contribute to NASH? 1. Purine degradation 2. H₂O₂ elimination 3. Β-oxidation 4. Plasmalogen synthesis 5. Both A and B 6. Both B and C 7. All are correct

Answer 182

c. B-oxidation

Question 183

1. Peroxins in the peroxisomes are analogous in role to which of the following proteins? 1. Translocons in the ER membrane 2. Importins in the nucleus 3. TOM in the mitochondria 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 183

c. Both I and III

Question 184

Which of the following organelles is surrounded by a double membrane? 1. Mitochondria 2. ER 3. Nucleus 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 184

c. Both I and III

Question 185

20% of the inner membrane lipid consists of… 1. Cardiolipin 2. Plasmalogen 3. G_M1 ganglioside 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 185

a. Only I

Question 186

Protein folding takes place inside which of the following organelles? 1. Mitochondria 2. ER 3. Nucleus 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 186

B. Both I and II

Question 187

An increased number of mitochondria in a cell directly correlates with… 1. Cell’s need for protein production 2. Energy needs 3. Number of ribosomes in the cell 4. Both A and B 5. None of the above

Answer 187

b. Energy needs

Question 188

When describing the outer mitochondria membrane, which of the following statements are correct? 1. Contains “porins” (integral proteins) 2. High content of cardiolipin phospholipid 3. Contains ETC enzymes 1. Only I 2. Both I and II 3. Both I and III 4. Both II and III 5. All of the above

Answer 188

A. Only I

Question 189

Barth syndrome is an X-linked cardiolipin synthesis disorder. Which of the following do you expect to be the least affected by this disorder? 1. Heart 2. Immune cells 3. Skeletal muscles 4. Adipose tissue 5. All of the above

Answer 189

d. Adipose Tissue

Question 190

All of the following takes place inside the mitochondria, except… 1. Electron transport chain 2. ATP synthesis 3. Glycolysis 4. Reactive oxygen species detoxification 5. Citric acid cycle 6. Oxidative phosphorylation 7. Conversion of pyruvate to acetyl CoA 8. Β-oxidation of fatty acids

Answer 190

c. Glycolysis

Question 191

Which of the following is TRUE of human mitochondrial DNA? 1. It is a double-stranded, linear DNA molecule 2. Like nuclear DNA, there are two copies per cell 3. It is comparable in size to small human chromosome 4. It carries all the genetic information necessary for mitochondrial function 5. There can be mixed populations of mitochondrial DNA in a cell 6. It is inherited only paternally

Answer 191

e. There can be mixed population of mitochondrial DNA in a cell.

Question 192

\_\_\_\_\_\_\_\_\_\_ occurs when a person’s cells carry a mixed population of mitochondrial DNA molecules. 1. Heteroplasmy 2. Homoplasmy 3. Heterogeneity 4. Homology 5. Homogeny

Answer 192

a. Heroplasmy

Question 193

Approximately what proportion of proteins that function in the mitochondria are encoded by the mitochondrial genome? 1. 1% 2. 10% 3. 50% 4. 90% 5. 100%

Answer 193

a. 1%

Question 194

The pedigree shows a family with multiple generations affected with myopathy that is characterized by the degeneration of muscle fibers. There is considerable variability in the severity of the symptoms even amongst siblings. The most likely cause of this variable expression is: 1. Gene complementation 2. Pleiotropy 3. The mitochondrial threshold 4. The mitochondrial bottleneck 5. Variable expression of nuclear and mitochondrial genes

Answer 194

d. The mitochondrial bottleneck

Question 195

Which of the following is TRUE of mitochondrial DNA replication? 1. There is a single replication origin, like a bacterial plasmid 2. Strands are replicated independently and asynchronously 3. There are dozens of replication origins, like a eukaryotic chromosome 4. Lagging strands synthesis produces Okazaki fragments 5. It requires proteins encoded in the mitochondrial DNA

Answer 195

b. Strands are replicated independently and asynchronolously

Question 196

During oogenesis, the expansion of mitochondria in the primordial germ cell, followed by a restriction of mitochondria in primary oocytes can result in… 1. Different proportions of mutant mtDNA in the offspring compared to the mother 2. Uniform proportions of mutation mtDNA in all the offspring 3. mtDNA instead being inherited from the father 4. Formation of a polar body 5. None of the offspring being affected by an mtDNA disease affecting the mother

Answer 196

a. Different proportions of mutant mtDNA in the offspring compared to the mother

Question 197

If a patient heteroplasmic for an mtDNA mutation, under what circumstance will a clinical condition occur? 1. Only if the mutation becomes homoplasmic following replicative segregation 2. Never 3. Only if the proportion of mutant mtDNA exceeds a threshold 4. Always 5. Only if the mutation is a giant deletion within the mtDNA

Answer 197

c. Only if the proportion of mutant mtDNA exceeds a threshold

Question 198

Which of the following mtDNA diseases can display homoplasmy? 1. MELAS Syndrome 2. MERRF Syndrome 3. NARP syndrome 4. Leber Hereditary Optic Neuropathy 5. Kearns-Sayre Syndrome 6. Maternally Inherited Leigh Syndrome

Answer 198

d. Leber Hereditary Optic Neuropathy

Question 199

A 30-year old female is seeking consultation for deterioration of her central vision due to degeneration of her optic nerve. Her peripheral vision is unaffected. The patient most likely has a mutation in the gene encoding which of the following? 1. DNA polymerase γ 2. ATPase6 of Complex V (ATP Synthase) 3. Mitochondrial lysine tRNA 4. Mitochondrial leucine tRNA 5. Subunit 4 of Complex I (NADH Dehydrogenase)

Answer 199

e. Subunit 4 of Complex I (NADH Dehydrogenase)

Question 200

AZT (aka Zidovudine) is an antiretroviral drug used in HIV therapy. It acts as an inhibitor of the viral reverse transcriptase. It has many negative side-effects including headaches, fever, nausea, liver and muscle damage, and lactic acidosis. Which of the following actions of AZT explains the side-effects? AZT… 1. Inhibits DNA polymerase δ 2. Creates pores in the mitochondrial inner membrane 3. Blocks the TOM/TIM translocase complex 4. Inhibits the twinkle helicase 5. Inhibits DNA polymerase γ

Answer 200

e. Inhibits DNA polymerase γ

Question 201

An 18-year old male began to experience bilateral ptosis. His father is also affected, with more severe weakness of his eye muscles and general myopathy. The physician suspects a mitochondrial disease. Which of the following mutations is most likely causing mitochondrial dysfunction? 1. Giant deletions of the mitochondrial DNA 2. Loss of function of TWNK 3. Point mutations in the mitochondria leucine tRNA gene 4. Point mutations in the miH dehydrogenase 5. Loss of function of NADH dehydrogenase 6. Loss of function of ATPase δ

Answer 201

b. Loss of function of TWNK

Question 202

Autocrine Motility Factor (AMF) receptors are transmembrane receptors that are frequently upregulated in invasive cancer cells. These invasive cancer cells secrete the AMF signaling molecule that activates their own AMF receptors to stimulate further proliferation and invasion. This type of signaling is referred to as… 1. Paracrine 2. Endocrine 3. Autocrine 4. Neuronal cell signaling 5. Contact-dependent

Answer 202

c. Autocrine

Question 203

After activation of a calcium-dependent signaling pathway, PKC is activated. Which second messenger or protein is needed for PKC activation? 1. IP₃ 2. cAMP 3. GRB2 4. CREB 5. RAS

Answer 203

a. IP₃

Question 204

Cyclic AMP (cAMP) is… 1. Formed by cAMP phosphodiesterase 2. Formed by adenylyl cyclase 3. A type of G-protein 4. Steroid hormone 5. A GAP (GTPase activating protein)

Answer 204

b. Formed by adenylyl cyclase

Question 205

If a cell acquires a loss of function of Ras, what would be the consequence of this? 1. The RTK will not dimerize 2. GRB2 will bind to the RTK 3. SOS will not bind to GRB2 4. Raf will not be activated 5. The RTK will not have activated tyrosine kinase activity 6. Growth factor will not bond to the RTK

Answer 205

d. Raf will not be activated

Question 206

The cholera toxin… 1. Locks the G_i in its inhibitory state which decreases cAMP 2. Locks the G_i in its active state which decreases IP₃ and DAG 3. Locks the G_s in its active state which increases IP₃ and DAG 4. Locks the G_s in its inhibitory state which decreases cAMP 5. Locks the G_s in its active state which increases cAMP 6. Locks the G_q in its active state which increases IP₃ and DAG

Answer 206

E. Locks the G_s in its active state which increases cAMP

Question 207

Activation of PLC will result in activation of… 1. PKA 2. PKB/AKT 3. PKC 4. Adenylyl cyclase 5. PI₃K

Answer 207

c. PKC

Question 208

The insulin receptor is an example of which type of signaling receptor? 1. Serine/threonine kinase receptor 2. Steroid hormone receptor 3. GPCR coupled receptor 4. Receptor tyrosine kinase 5. Receptor serine/threonine kinase 6. Cytokine receptor

Answer 208

D. Receptor Tyrosine Kinase

Question 209

Cells biopsied from a 36-year old female with breast cancer were identified as estrogen receptor-positive. Which of the following most correctly describes the class of receptors to which estrogen receptors belong? 1. Intracellular receptors 2. G-protein coupled receptors 3. Receptor tyrosine kinases 4. Receptor serine/threonine kinases endocrine 5. Cytokine receptors

Answer 209

a. Intracellular Receptors

Question 210

An increase in cAMP production and PKA activation will result from the activation of a GPCR coupled to… 1. G_q locked in its activation stated 2. G_i locked in its inactive state 3. G_s locked in its inactive state 4. G_q locked in its active state which increases cAMP 5. G_i locked in its active state

Answer 210

b. G_i locked in its inactive state

Question 211

If a cell acquires a loss of function of Mek, what would be the consequence of this? 1. The RTK will not dimerize 2. GRB2 will not bond to the RTK 3. SOS will not bind to GRB2 4. MAPK will not be activated 5. Raf will not be activated 6. Growth factor will not bind to the RTK

Answer 211

D. MAPK will not be activated.

Question 212

Activation of a G_q coupled protein receptor (GPCR) will result in the generation of 1. PKA 2. cAMP 3. PIP₃ 4. PIP₂ 5. IP₃ 6. PI₃K

Answer 212

e. IP₃

Question 213

Cholesterol

Answer 213

* On oth leaflets * For extrutural stability. * Hydrophobic with one single exception (OH)

Question 214

Phosphatidylserine

Answer 214

* 2 negatives * 1 positive leaflet * if outside, it will trigger apoptosis. * Inner leaflet. * Asymmetry: mainained by flippases.

Question 215

Acanthocyte

Answer 215

Spur cell Anemia Increased cholesterol in RBC's membranes 5-10 irregular, blunt, figer-like projections

Question 216

G Protein Cycle; GTP "swithch"

Answer 216

* Small monomeric G Proteins * \> 100 small G proteins, 5 families: **RAS**, RHO, RAB, **RAN**, ARF * Switched "Off", bound to GDP ( GAPs Hydrolase GTP) * Turned "On" by binding GTP (GEF's exchange GDP for GTP)

Question 217

Exportin

Answer 217

* Ran-GTP bound exportin which binds to cargo and nucleoporins, ativates translocation through NPC

Question 218

Lamin phosphorylation

Answer 218

* During prophase by Cdk1 * Nuclear envelop dissasembly into vesicles containing lamin B * Lamins A&C released as free dimers * Lamin B= anchored to inner membrane * **Inactivation of Cdk1------ Lamin dephosphorylation** ​**​​** * Membrane vesicles bind chromosome surface --------\> Reassembly

Question 219

Laminopathies

Answer 219

1. Lipodystrophy 2. Skeletal/ cardiac muscular distrophies 3. Progeria. All caused by Defects in lamin assembly. Symptoms: * Develop during childhood, fragile nuclear envelope (affects physically distressed tissues: muscle fibers, bone, skin, connective tissue) * Disruption of nuclear function: Aberrant distribution of chromosomes or interaction with specific TFs is altered.

Question 220

Emery-Dreifuss muscular distrophy

Answer 220

* Is a skeletal and cardiac myopathy * Mutation Emerin or Lamin A/C

Question 221

Dilated Cardiomyopathy

Answer 221

* Skeletal and cardiac myopathy * Lamin A/C defect (rare cause) * Fragile nuclear lamina --\> nuclear structures/contents damaged----\> cell death---\> congestive heart failure.