MCB Extras for Unit 1 Flashcards by Diana Artiles

Ciprofloxacin (Cipro) is a broad spectrum antibiotic that is often used to treat infections for which the bacterial pathogen has not been identified, including urinary tract infections and abdominal infections. The mechanism of action of this antibiotic in bacteria is as an inhibitor of which of the following enzymes?

A. DNA Gyrase (Type II Topoisomerase)

B. RNA polymerase

C. Reverse Transcriptase

D. Helicase

E. DNA polymerase III

A. DNA Gyrase (Type II Topoisomerase)

How well did you know this?

Not at all

Perfectly

A patient with Ewing sarcoma is given etoposide as part of his chemotherapy regimen. This drug interferes with topoisomerases. Topoisomerases are responsible for which of the following actions?

A. DNA polymerization

B. Formation of DNA breaks during unwinding

C. RNA primer synthesis

D. joining of the Okasaki fragments

E. RNA primer degradation

B. Formation of DNA breaks during unwinding.

How well did you know this?

Not at all

Perfectly

A patient comes to clinic because her family has a history of multiple cancers at early ages, but they have tested negative for all the known familial cancer syndromes. A genetic marker, “ILB,” appears to be inherited with the unknown mutation in this family. The marker is present in six of her seven family members with the early cancers, but is absent in her maternal aunt, who has early-stage cancer. This finding in the maternal aunt likely results from:

A. Crossover during anaphase, causing the marker to be linked to the disease

B. Crossover during metaphase, causing the marker to be unlinked from the disease in this subject

C. Crossover over during metaphase, causing the marker to be linked to the disease in this subject

D. Crossover during prophase causing the marker to unlink from the disease in this subject

E. Crossover during prophase, causing the marker to be linked to the disease in this subject

D. Crossover during prophase causing the marker to unlink from the disease in this subject.

How well did you know this?

Not at all

Perfectly

Which is the second enzyme to function in prokaryotic DNA replication?

Primase

How well did you know this?

Not at all

Perfectly

What is the first enzyme that is active in prokaryotic DNA replication?

Helicase

How well did you know this?

Not at all

Perfectly

What is the third enzyme to function in prokaryotic DNA replication?

DNA Polymerase III

How well did you know this?

Not at all

Perfectly

A 12-year-old boy has learned that his mother’s husband may not actually be his biological father. He is determined to learn the truth, so he asks his mother for help. Unfortunately, the mother is not really sure, so they hire the services of a well-respected geneticist. This professional devises a test that he thinks will be specific. He knows of ways to cut chromosomal DNA at specific small palindromic sequences so that different alleles will give different patterns of cut fragments. He applies this technique to donated samples of DNA collected from all interested parties and soon finds one version of his test that yields a definitive result. .

He has taken DNA samples from three men, as well as on the boy’s mother (M), her husband (H), and the boy himself (B) to perform his test, and the resulting fragments are separated by agarose gel electrophoresis and then probes these DNA pieces with a labeled DNA probe that is known to hybridize to all the known alleles of one particular gene. Analyze the indicated lanes of this DNA gel and determine what conclusion can be drawn. Who is the boy’s father?

A. H

B. 1

C. 2

D. 3

E. None of these

F. We cannot tell .

D. 3

How well did you know this?

Not at all

Perfectly

An experimenter obtains tissue samples from a normal 80-year-old patient and a normal 25-year-old patient and grows fibroblasts from these samples in an in vitro cell culture system. She finds that cells from the older patient stop dividing much sooner than cells from the younger patient. This finding is most likely explained by a difference in which of the following?

A. circulating levels of cytokines

B. growth factor activity

C. hormonal levels

D. oncogene expression

E. telomere length

F. levels of tumor suppressors

G. we have no explanation

E. Telomere Lenght

How well did you know this?

Not at all

Perfectly

Which kind of DNA repeat could be part of a cancerous change in which its genetic information is activated to produce an unwanted reverse transcriptase?

A. An ALU SINE

B. A paloindromic tandem repeat

C. A type I LINE

D. A type II LINE

E. The telomere

C. A type I line.

How well did you know this?

Not at all

Perfectly

A mutation in a beneficial gut-associated bacterium prevents it from taking it rightful place in the intestinal flora. When this mutation is studied in the molecular biology lab, it is discovered that the problem lies in DNA replication. Careful study reveals that during DNA replication, the leading strand is made at the normal rate, but the lagging strand is barely made at all. Most known mutations cause an important protein to malfunction or to be made in very low amounts. Which of these proteins could be the cause of this observed defect in DNA replication?

A. DNA gyrase

B. DNA polymerase III

C. DNA polymerase I

D. the major helicase

E. DNA polymerase II

F. DNA polymerase a

G. The Primase

H. DNA polymerase d

I. DNA polymerase e

C. DNA Polymerase I

How well did you know this?

Not at all

Perfectly

Bacteria contain all but which of the following?

A. Circular chromosomes

B. Introns

C. Plasmids

D. Topoisomerase I

E. Topoisomerase II

B. Introns

How well did you know this?

Not at all

Perfectly

Which statement is correct regarding DNA repeats?

A. The repeating units in DNA repeats are always completely identical copies of each other

B. Repeats represent about 4% of the human genome

C. LINE elements cluster at telomeres

D. Inverted repeats in coding regions may cause hairpin formation in RNA

E. All DNA repeats in the human genome are biologically silent and not associated with any disease.

D. Inverted repeats in coding regions may cause hairpin formation in RNA

How well did you know this?

Not at all

Perfectly

The telomere is considered to be what type of highly repeated DNA sequence?

A. Satellite

B. Minisatellite

C. Microsatellite

D. Tandem

B. Minisatellite

How well did you know this?

Not at all

Perfectly

The following is a group of statements that putatively describe type I LINEs. Which combination of these statements is TRUE?

(I) they replicate through an RNA intermediate

(II) they utilize reverse transcriptase for replication

(III) they contain introns

(iv) they are much more plentiful than Type II LINES

A. I, II & IV B. I, II & III C. only I & II D. only I & III

E. only I & IV F. I, II, III & IV G. only II

A. I, II, & IV

How well did you know this?

Not at all

Perfectly

After an exhaustive digestion of nuclear DNA with micrococcal nuclease, the majority of DNA is protected from digestion. It remains as double-stranded DNA fragments firmly bound to which of the following?

A. histone H1

B. histone H2A and H2B

C. the nucleolus

D. the topoisomerase

E. an octamer of basic histone proteins

F. a complex of DNA polymerase and helicase

E. An octamer of basic histon proteins

How well did you know this?

Not at all

Perfectly

What type of chromatin is inactive and viewed in a micrograph of an interphase nucleus as dense dark clusters of protein and DNA?

A. heterochromatin

B. sister chromatids

C. homologous chromosomes

D. 10 nm fiber

E. 30 nm fiber

F. euchromatin

A. hererochromatin

How well did you know this?

Not at all

Perfectly

Which one of these statements describes a very important difference between DNA polymerases and RNA polymerases?

A. RNA Polymerase requires a primer, DNA Polymerase does not.

B. DNA Polymerase requieres a primer, RNA Polymerase does not

C. They both need primers and there is no difference between them.

D. RNA Polymerase is faster than DNA Polymerase

B. DNA Polymerase Requires a primer, RNA polymerase does not.

How well did you know this?

Not at all

Perfectly

What is the purpose of a primer during the process of DNA replication?

A. Provides a 3’ OH group to which nucleotides are added

B. Provides a 5’ OH gorup to which nucleotides are added.

C. Its needed for RNA Polymerase to start transcription

D. A primer is optional for DNA Polymerase

A. Provides a 3’ OH group to which nucleotides are added.

How well did you know this?

Not at all

Perfectly

Histone proteins are rich in what two amino acids?

A. the aromatic amino acids – tryptophan and phenylalanine

B. negatively charged amino acids – such as glutamate and aspartate

C. guanine and leucine

D. inosine and alanine

E. the positively charged amino acids – arginine and lysine

F. polar amino acids – such as glutamine and asparagine

E. The positively charged amino acides- Arginine and Lysine

How well did you know this?

Not at all

Perfectly

After the digestion of nuclear DNA with micrococcal, the 146 bp DNA fragment found after isolating the nucleosomes and treating them with a high concentration of salt is the:

A. DNA Connecting the nucleosomes

B. DNA wrapped around the nucleosomes

C. H1 Histone

D. Chromosomal scaffold.

B. DNA wrapped around the nucleosomes.

How well did you know this?

Not at all

Perfectly

How many replication forks form up when a bacteria replicates its chromosome?

A. 1

B. 2

C. 3

D. 4

E. 8

F. Hundreds

B. 2

How well did you know this?

Not at all

Perfectly

How many replication forks are formed when a human cell replicates all its chromosomal DNA?

A. 1

B. 2

C. 3

D. 4

E. 8

F. Hundreds

G. Thousands

H. Several Hundred Thousands.

How well did you know this?

Not at all

Perfectly

Which one of the following statements is true about the helicases?

A. Rewind: the two template strands after they have been completed replicated.

B. Unwind positive supercoils

C. Assemble the replisome

D. Consume ATP

How well did you know this?

Not at all

Perfectly

Mammalian DNA Polymerase alpha are involved in:

A. Priming and partial synthesins of the lagging strand

B. DNA Repair

C. Replicates mitochondrial DNA

D. Removal of oikazaki fragments.

A. Priming and partial synthesis of the lagging strand.

How well did you know this?

Not at all

Perfectly

A dideoxy ribonucleotide differs from a deoxyribonucleotide only by: A. incorporation of inosine instead of thymine B. incorporation of uracil instead of thymine C. incorporation of thymine instead of uracil D. lack of a 2’ hydroxyl E. lack of a 3; hydroxyl

E. Lack of a 3; Hydroxyl

In prokaryotes, the sliding clamps for the DNA polymerases are simply composed of the g- and b-subunit of the protein complex. However, in eukaryotes, the sliding clamp is largely composed of which one of these important proteins (shown as the abbreviation usually used to name them)? A. DNA A B. SSB C. RFC D. PCNA E. GAPDH F. GSK

D. PCNA

Which enzyme stitches together the small pieces of DNA on the lagging strand? A. helicase B. ligase C. gyrase D. phosphodiesterase E. DNA kinase

B. Ligase

What is wrong with the following statement: “Reverse transcriptase was first understood through the study of RNA viruses. They have three enzymatic activities that help them invade their host, but they have no proofreading capability.” A. Reverse Transcriptase was found in DNA viruses B. Reverse Transcriptase also expresses an RNA-dependent RNA polymerase activity, a 4^th enzymatic acivity C. Reverse Transcriptase *does* have proofreading capability D. There is really nothing wrong with the statement

D. There is really nothing wrong with the stament.

Telomerase is a special version of a Reserve Transcriptase that uses a … (1) … template to solve the … (2) …. Problem. A. (1) DNA (2) end replication problem B. (1) RNA (2) End replication problem. C. (1) RNA (2) t-loop problem D. (1) DNA (2) t-loop problem

B. (1) RNA (2) End replication problem.

What is the sequence of the TEMPLATE DNA from which the following DNA was obtained in a sequencing reaction? A. ACCGTACATTAAA B. TGGCATGTAATTT C. TTTAATGTACGGT D. TTTAATGGACGAT E. AAATTACATGCCA

C. TTTAATGTACGGT

Which one of the following statement about the polymerase chain reaction (PCR) is correct? A. DNA is amplified can easily be over 100 000 basepairs long. B. DNA must be heat-denatured before the first round of DNA synthesis begins, but not thereafter C. The boundaries of the amplified DNA segment are determined by the symthetic oligonucleotides used to prime DNA synthesis. D. RNA can be directly amplified by the PCR reaction.

C. The boundaries of the amplified DNA segment are determined by the symthetic oligonucleotides used to prime DNA synthesis.

The sequence of the following DNA fragment is resequenced with the Sanger dideoxy sequencing method, but with only dideoxy T insted of all dedeoxy nucleotides (N stands for any nucleotide). How many tterminated DNA fragments can be detected in the 101-109 bases size range? A. 0 B. 2 C. 4 D. 10

C. 4

The Following compaund is: A. Uracil B. Thymidine C. Cytosine D. Adenine

C. Cytosine

One strand of a DNA molecule contains 20A's, 25 G's, 30 C's and 22 T's. How many each base is found in the complete double-stranded molecule? ## Footnote A. A= 40, G= 50, C= 60, T=44 B. A= 44, G= 60, C= 52, T= 40 C. A= 45, G= 45, C= 52, T= 52 D. A= 50, G= 47, C= 50, T= 47 E. A= 42, G= 55, C= 55, T= 42

E. A= 42, G= 55, C= 55, T= 42

How many different versions of a 20 nucleotide single-stranded nucleic acid can there be? A. 4 to the power of 20 B. 4 to the power of 11 C. 11 to the power of 4 D. 20 to the power of 4

A. 4²⁰

Methylation of eukaryotic DNA most commonly occurs at: A. CpG sequences B. ApT sequences C. UpT sequences D. GpA sequences

A. CpG sequences

Which of the following is a palindromic sequence? A. AGGTCC B. CCTTCC C. GAATCC D. GGATCC

D. GGATCC

Epigenetics is the study of … ? A. changes in gene function that are inheritable but do not entail a change in DNA base sequence B. changes in gene function that take place outside of the nucleus C. changes in gene function that take place only within the mitochondrion D. changes in gene function that are inheritable due to a known change in DNA base sequence E. changes in gene function that are inheritable due to the accumulation of DNA mutations

A. changes in gene function that are inheritable but do not entail a change in DNA base sequence

If you were to take the amino group off 5-methyl-cytosine, what base would you get? A. becomes A B. stays C C. becomes T D. becomes U E. becomes G

C. Becomes Thymine

What happens if you acetylate a basic lysine or arginine in a histone that is associated with some DNA? A. nothing happens, although the side-chain is longer B. the basic residues become acidic and attach the rest of the protein C. the side-chains begin to wrath about – and this destroys the adjacent DNA molecule D. the positive charge is neutralized and the histone no longer grips the DNA as tightly E. the nucleosome of which this histone is a part flies apart in complete disintegration

D. the positive charge is neutralized and the histone no longer grips the DNA as tightly

Assuming that a certain amount of methylation is found in the CG islands of our genome (as it is), what could be the effects of hypomethylation? A. inappropriate activation of genes and chromosomal elements that are supposed to be suppressed B. shutting down some of the essential genes that we need C. nothing at all will change D. translation will cease E. DNA replication will cease

A. inappropriate activation of genes and chromosomal elements that are supposed to be suppressed

A researcher has determined that the chromatin in his sample is composed of rosette loops that are beginning to form coils. What would we probably term this type of chromatin in our class? A. way crazy chromatin B. all loopy chromatin C. beyond loopy chromatin D. groovy chromatin E. euchromatin F. heterochromatin G. clotted chromatin

F. Heterochromatin

Is it typical for genes within heterochromatin to be expressed? A. infrequently B. No C. Yes D. often E. only when the nucleolus is active F. only when the chromatids have formed

B. NO

* Using the depiction of replicating prokaryotic DNA shown in the image, which direction is the replicaiton fork moving? * Which is the laggin Strand? * Where would we find the Primase? * Where on this figure would you find the helicase? * Where would the okazaki Fragments be found?

* To the left. * The top strand is the lagging strand. * Copies of Primase will periodically be associated with the lagging (top) strand * Helicase is right behind the point of the fork- next to the duplex region & opeining it up. * Okazaki Fragments are base- paired to most of the lagging (top) strand.

The DNA area indicated below must be amplified in order to check for mutations in the ‘region of interest’. Which of these choices shows you a set of primers that can be used to direct the PCR process and amplify a piece of DNA that includes the ‘region of interest’? A. GTGCAACCCGCCAATGC and ATGCCATGCATACCGAGA B. TACGGTACGTATGGCTCT and CACGTTGGGCGGTTACG C. AGAGCCATACGTACCGTA and GCATTGGCGGGTTGCAC D. CGTAACCGCCCAACGTG and TCTCGGTATGCATGGCAT

D. CGTAACCGCCCAACGTG and TCTCGGTATGCATGGCAT

Compared to covalent bonds noncovalent bonds are …..(1)…. and act over …..(2)….. distances a. (1) stronger; (2) longer b. (1) stronger; (2) shorter c. (1) weaker; (2) longer d. (1) weaker; (2) shorter

D. (1) Weaker; (2) Shorter

When all is considered, hydrophobic interactions help stabilize what type of interactions? 1. binding of a hormone to its receptor protein 2. enzyme-substrate interactions 3. membrane structure 4. three-dimensional folding of a polypeptide chain 5. all of the above are true

E. All of the above are true

Which two amino acids (side chains shown) are participating in this hydrophobic interaction? 1. Serine and Tryptophan 2. Cystine and Glutamine 3. Alanine and Tyrosine 4. Leucine and Phenylalanine

D. Leucine and Phenylalanine

The three-dimensional structure of macromolecules is formed and maintained primarily through noncovalent interactions. That said, which one of the following is considered a covalent bond? 1. disulphide bridges 2. hydrogen bonds 3. hydrophobic interactions 4. ionic interactions 5. van der Waals interactions

B. Disulphide Bridges.

As suggested in class, computer analyses reveal that beta-turns (a.k.a., reverse beta-turns) are rich in which amino acids? 1. Lysine and Arginine 2. Glutamate and Aspratate 3. Tyrosine and Phenylalanine 4. Proline and Glycine e. Cysteine and Methionine

D. Proline and Glycine

A certain monogenic disorder is caused by a faulty mutant regulatory protein which malfunctions due to loss of the correct 3D structure. The mutation causes the loss of a beta turn, and the two adjoining beta sheets orient at the wrong angles with respect to the central axis of the globular protein. Which of these amino acid substitutions would be most likely to result in a dysfunctional protein? 1. Alanine to Valine 2. Glutamate to Aspartate 3. Glycine to Arginine 4. Serine to Asparagine 5. Lysine to Arginine

C. Glycine to Arginine

A genetic disease features the malfunction of a synaptic protein due to a single-gene mutation. This synapse-stabilizing protein fails to bind to its partners due to an altered shape brought about by the loss of a crucial alpha-helix at a central protein-to-protein contact site. Which of these amino acid substitutions would be most likely to result in this dysfunctional protein? 1. Alanine to Valine 2. Glutamate to Aspartate 3. Serine to Asparagine 4. Glutamate to Proline 5. Lysine to Arginine

D. Glutamate to Proline

Which of the following is correct with respect to the amino acid sequences of proteins? 1. Larger proteins have a more uniform distribution of amino acids than smaller proteins. 2. Proteins contain at least one each of the 20 different standard amino acids. 3. Proteins with different functions usually differ very significantly in their amino acid sequence. 4. Proteins with the same molecular weight have the same amino acid sequence. 5. The average molecular weight of an amino acid in a protein increases with the size of the protein.

C. Proteins with different functions usually differ very significantly in their amino acid sequence.

If the following mixture of the five proteins sere to be applied to a size-exclusion chromatography column, which protein would come off (elute) as the third peak? 1. cytochrome *c**M*_r = 13,000 2. immunoglobulin G *M*_r = 145,000 3. ribonuclease A *M*_r = 13,700 4. RNA polymerase *M*_r = 450,000 5. serum albumin *M*_r = 68,500

E. Serum Albumin M_r = 68,500

A blood plasma sample is separated on a column consisting of beads that are charged positively at the pH of the buffer solution used (an anion-exchange column). Upon further application of buffer solution, which proteins will elute first? 1. Positively charged 2. Negatively charged 3. Aromatic 4. Neutral

1. Positively charged.

Genetic laboratories often analyze biopsy samples to detect or exclude abnormalities. For example, if a physician were to remove a sebaceous cyst from the bottom of your foot, he would send a sample to a pathologist or to the genetics lab to determine if follow-up is required. The following diagram summarizes the results of a Western blot performed using a specific antibody against the MAGMA-7 protein against protein extracts of polyps taken from the identified colonoscopy patients. Abnormal splicing of the MAGMA-7 gene is common to most of the adenocarcinomas found in the sigmoidal colon and results in an enlarged protein that helps cause all the trouble. The abnormal protein acts in a dominant fashion – meaning that an abnormal protein will not be “cloaked” by the presence of a normal protein. Which of these patients needs to be examined more carefully to determine whether true adenocarcinoma has developed?

S1497, S1952 & 2S017

You have seen a patient with a very rare disorder and based on the symptoms you suspect that one of the proteins produced in the liver is not functioning properly. You sent a liver biopsy of the patient off to the biochemical laboratory for protein analysis. They report back to you that they indeed did found one aberrant protein from among a mixture of 5000 proteins visualized from the biopsy sample. It turned out that the aberrant protein was shorter than normal and had lost several negative charges from its surface. What kind of technique did the laboratory most likely use to arrive at this finding within 1 or 2 days? 1. Sodium dodecyl sulfate polyacrylamide gel electrophoresis 2. Isoelectric focusing 3. Size-exclusion chromatography (aka gel-filtration) 4. Affinity chromatography 5. Two-dimensional gel electrophoresis (isoelectric focusing + SDS PAGE sizing)

E. Two-dimensional gel electrophoreis (isoelectric focusing + SDS PAGE sizing)

The tighter the binding between ligand and receptor, the _______ the association constant and the _______ the dissociation constant. 1. Higher, Higher 2. Lower, Higher 3. Higher, Lower 4. Lower, Lower

C. Higher, lower

An anion-exchange column is used to separate the following collection of proteins extracted from a tumor. The column is eluted using an increasing gradient of NaCl (0 – 500 mM, linear). Which protein will elute as the third peak off the column? A.BPX – 4 positive and 6 negative charges on its surface B. MAKA – 4 positive and 5 negative charges on its surface C. MAGMA-7 – 7 positive and 2 negative charges on its surface D. GDTRFB – 4 positive and 7 negative charges on its surface E. GOT-9 -- 2 positive and 2 negative charges on its surface

B. MAKA – 4 positive and 5 negative charges on its surface

Whata is an antibody?

Specific binding proteins with High Affinity, Used as a regent, etc.

You are conducting Sanger sequencing of a DNA fragment, you just happen to know the following sequence of the template strand: p-??????????(???)???????????CGATATCGACACACTGTAGCCACGGG . You procure the following primer to use in your reaction: CCCGTGGC . If you were to conduct your sequencing reaction with only ddATP, how many chain terminations would you get in the known region? A. 2 B. 3 C. 4 D. 6 E. 7 F. 9 G. 11 H. 1 Asking the same question a different way. IF the frist base of your primer is numbered 1, then at what positions do you observe the chain terminations from the ddATP reaction? A. 9, 14, 16, 18, 22 & 24 B. 5, 9, 14, 16, 18, 22 & 24 C. 12, 21 & 23 D. 10, 12 & 23 E. 10, 12, 21 & 23

C. 4 E. 10, 12, 21 & 23

What structure is labeled **‘18’** in this figure of a protein? A. a domain, a tertiary structure B. a beta-sheet, a tertiary structure C. a beta-sheet , a secondary structure D. an alpha-helix, a tertiary structure E. an alpha-helix, a secondary structure

E. An alpha-helix, a secondary structure

What structure is labled ‘**19**’ in this figure of a protein? A. a domain, a tertiary structure B. a beta-sheet, a tertiary structure C. a beta-sheet , a secondary structure D. an alpha-helix, a tertiary structure E. an alpha-helix, a secondary structure

A. a domain, a tertiary structure.

Which of these values describes a receptor – ligand binding equilibrium that demonstrates the highest affinity (tightest binding)? A. Kd =10 nM B. Kd = 1 nM C. Kd = 1 pM D. Kd = 100 pM E. Ka = 1 X 10 ¹⁰ F. Ka = 1 X 10 ¹¹

C.Kd= 1pM

Which amino acid is this? A. leucine B. isoleucine C. phenylalanine D. tyrosine E. Methionine F. tryptophan

F. Tryptophan

Is this amino acid basic or acidic?

Acidic

IS this amino acid basic or acidic?

Charged, Basic (Lysine)

What is the correct term to describe the feature labeled as 24 in this depiction of a protein? A. proteinacous sulfhydryl-sulfhydryl bond B. intrachain disulfide bond C. interchain disulfide bond D. bimethionyl linkage E. bimethionine bridge F. dicysteine bridge

C. Interchain Disulfied bond

If the following mixture of the five proteins were separated by SDS reducing gel electrophoresis, which protein would be the third band from the top of the gel? 1. cytochrome *c**M*_r = 13,000 2. immunoglobulin G *M*_r = 145,000 3. ribonuclease A *M*_r = 13,700 4. RNA polymerase *M*_r = 450,000 5. serum albumin *M*_r = 68,500

E. Serum Albumin M_r= 68, 500

If the following mixture of the five proteins were separated by SDS reducing gel electrophoresis, which protein would migrate the farthest on the gel? 1. cytochrome *c**M*_r = 13,000 2. immunoglobulin G *M*_r = 145,000 3. ribonuclease A *M*_r = 13,700 4. RNA polymerase *M*_r = 450,000 5. serum albumin *M*_r = 68,500

26- cytochrome *c**M*_r = 13,000

An isolated protein receptor is being tested with hormones and analogous molecules. Molecule X binds with a measured Kd of 1 X 10 -10 and molecule Y binds with a measured Kd of 1 X 10 -9. Molecule Z binds with a Kd that is measured as 3.5 X 10-11. The receptor has the highest affinity for which molecule?

Z 3.5X10^-11

A sugar-binding molecule (a lectin) is tested for its ability to bind several related sugars. This unusual enzyme binds fucose with a Kd of 2 X 10-9, glucose with a Kd of 3 X 10-9, galactose with a Kd of 1 X 10-8, mannose with a Kd of 3 X 10-8, and xylose with a Kd of 1 X 10-9. Which sugar does it bind with the highest affinity?

Xylose: Kd of 1X 10^-9

An unstudied orphan protein has been identified as a steroid hormone receptor. It is tested with common steroid hormones to determine its specificity. The following Kd’s are determined: 35 nM for estrogen, 95 nM for progesterone, 0.1 nM for hydrocortisone, 300 nM for testosterone, and 450 nM for dihydroxy-testosterone. What kind of receptor does this protein seem to be?

Hydrocortysone 0.1 nM

In the below diagram of a transcription bubble, which letter marks the 5' end of the template strand? A. B. C. D. E.

Wiskott-Aldrich syndrome is an ***X-linked recessive disease*** characterized by immunodeficiency, thrombocytopenia and eczema. A broad spectrum of mutations in the WASP gene is now known to cause the disease. In one case, expression studies of the mRNA of a ***male*** patient's sample showed the presence of two poly-adenylated transcripts that differed only in the length of the 3' untranslated region. *At a minimum the mutation carried by this patient most likely altered:* A. The TATA box in the promoter B. The AAUAAA polyadenylation site C. A splice donor site D. A splice acceptor site E. The stop codon F. A 5’ splice donor site

B. The AAUAAA polyadenylation site. Since this is an X-linked recessive disorder (which is now a specified in the revised question), only one gene needs to be affected for a male to suffer the disease. In this case an extensive mutation causes an aberrant protein to be produced, and it is this abnormality of the protein that actually causes the disease. However, an XY person with this disorder has only one affected gene, but two polyadenylated transcripts were produced, rather than one. If only one mutation (no matter how large or weird) caused this problem, then it must have somehow involed in poly-adenylation/cleavage site. IT would appear, then, that one or the other of the signals is being used to terminate the mRNA and supply the poly (A) tail. For one mutation in one gene; it has to be somethin like the presence of two alternative sites that would allow production of two distinct poly (A) transcripts - Instead of just one. For the complete explanation, it turns out that a large deletion was present linked to a short inversion. The deletion knocked out all of exon-12 so that any RNA produced would be missing this crucial part of the coding sequence for the WAS protein. However, next to this deletion was the 9-bp inversion, and this inversion managed to produced a new alternative polyadenylation/ cleavage signal. The affected cells then used one polyadenylation/ cleavage signal or the other in a more or less random fashion two closely related (and abnormal) mRNAs that differed in lenght. Since the gene only had 12 exons, these abnormalities were all concentratred near the 3' end.

Rifampicin is an antibiotic commonly used to treat infections by Mycobacterium tuberculosis. The mechanism of action of rifampicin is as an inhibitor of which of the following enzymes? A. RNA polymerase B. DNA polymerase III C. Gyrase D. Peptidyl transferase E. Reverse transcriptase F. DNA polymerase I

F. RNA Polymerase

(Covers translation.) What step of translation could be affected if there is a mutation in a nucleotide within the 3’ sequence of the prokaryotic 16S RNA? A. Elongation B. Termination C. Recognition of the starting AUG codon D. Binding of the 50S subunit to the 30S subunit E. Entry of an Aminoacyl-tRNA into the A-site of the ribosome

C. Recognition of the starting AUG codon

The following sequence is an anticodon in a tRNA: 5'-UGC-3'. Use the Genetic code to determine which amino acid will be covalently linked to the tRNA. A. Ala B. Thr C. Cys D. Arg E. Leu

A. Ala

A novel putative protein identified by the human genome project has a coding sequence of 75 base pairs coding for a protein of 25 amino acids. Assuming this protein is expressed, ***approximately*** how many high-energy phosphate bonds (from either ATP or GTP) would be required as an energy source for translation? A. 300 B. 100 C. 75 D. 50 E. 25

B. 100

Which splicing factor recognizes and binds the 5’ donor site” A. U1 snRNP B. U2 snRNP C. U3 snRNP D. U4 snRNP E. U5 snRNP F. U6 snRNP

A. U1 snRNP

Which of the below diagrams correctly depicts a ribosome after the first peptidyl transferase step?

The Wobble hypothesis essentially states that: A. Several mRNA codons may pair with a single tRNA anticodon B. tRNAs wobble when attached to an mRNA C. A single mRNA codon can pair with only a single tRNA anticodon D. There are too many tRNAs present to account for the number of amino acids E. An mRNA codon may pair with more than one tRNA anticodon F. tRNAs make the ribosome wobble

E. An mRNA codon may pair with more than one tRNA anticodon

The following protein coding sequence undergoes a point mutation as shown: ## Footnote This is an example of Which type of mutation: A. Conservative missense B. Silent C. Nonsense D. Frameshift E. Non-conservative missense

C. Nonsense

Which snRNP is the most important single factor in successively splicing an intron out of a nascent RNA in human nuclei? A. U1 B. U2 C. U3 D. U4 E. U5 F. U6 G. the Exon Junction Complex H. the PAK enzyme

B. U2

The following protein coding sequence undergoes a point mutation as shown: This is an example of which type of mutation: A. Conservative Missense B. Silent C. Nonsense D. Frameshift E. Non-conservative Missense

B. Silent

1. Which band Probably indicates the primary transcript? 2. Which labeled band indicates the mature mRNA?

1- F 2. A

See if you can list the enzymes that accomplish the capping of an human nascent RNA in the nucleus.

These enzymes are in the nucleus and ride in the tail of RNA polymerase II. There are two main ones. Guanylyltransferase. Guanine-7-Methyltransferase

What is the name of the enzyme that adds poly(A) tail to produce mRNA.

Polyadenylate Polymerase This enzyme finds RNA polymerase II's Tail as part of a complex

The name of the short base sequence at the end of an intron is: A. splice donor site B. splice spacer site C. intron location site D. splice acceptor site E. branch A splice site F. 3’ splice recognition site G. ribosome binding site

D. Splice Accpetor site

Prokaryotes use a specificity factor to lead an RNA polymerase to a specific promoter site to start transcription. These transcriptional factors are termed: A. telomeres B. DNA polymerases C. reverse transcriptases D. core histones E. repressors F. sigma factors G. Nu proteins H. scaffolding proteins

F. Sigma Factor

Briefly describe the difference between Rho-dependent and Rho-independent termination of transcription.

Rho -Dependent Termination Uses ATP to bind CA-rich region in a nascent RNA chain upstream of termination site. Also climbs up RNA strand until it catches up with RNA Polymerase and Moves in and unwinds the mRNA-DNA duplex to free RNA. Rho-Independent termination, RNA G-C region forms a stron hairpin structure (Palindrome) , RNA polymerase pauses, then combinde effects of weak U-A bonding in RNA/DNA hybrid immediately adjacent to stron G-C RNA hairpin. RNA is pulled off the DNA template.

What is one of the main ways in which the activity of RNA polymerase II is controlled? A. differential phosphorylation of the CTD tail B. methylation of the active site C. acetylation of the active site D. interaction with the Rho helicase E. tethering to the nuclear membrane

A. Differential phosphorylation of the CTD tail

What is one of the major post-transcriptional mechanisms that permits eukaryotes to produce multiple RNAs from a single gene? A. nuclear ribosomal shuffling B. tandem polymerase stacking C. polymerase hybridization D. alternate RNA splicing mechanism

D. Alternate RNA splicing mechanism

What major feature of a mature eukaryotic mRNA seems to largely determine how long it will last? A. length of the poly(A)-tail B. number of exons C. presence or absence of cryptic introns D. average length of the exons

A. Lenght of the Poly(A) Tail

Roughly how large are the tRNAs? A. 22-28 bp B. 44-52 nt C. 100-120 nt D. 74-95 nt E. 1000 – 1250 nt

D. 74-05 nt

Roughly how large are the immature miRNAs? A. 22-28 bp B. 44-52 nt C. 100-120 nt D. 74-95 nt E. 1000 – 1250 nt

A. 22-28 bp

What is the name of the major endonuclease contained within the RISC complex? A. Jason B. Sam C. Dicer D. Dasher E. Blitzen F. Argonaute G. Drosha

F. Argonaute

Which of these represents one unusual characteristic of prokaryotic transcription? A. RNA polymerases do not need a primer B. DNA Polymerase I can replace RNA with DNA C. prokaryotic ribosomes bind to the RNA polymerase D. prokaryotes utilize 3 distinct RNA polymerases E. prokaryotic ribosomes require an AUG start codon F. proteins are made on the ribosomes G. prokaryotes begin to translate the mRNA while it is still being made

G. Prokaryoties begin to translate the mRNA while is still being made

Sigma factors clearly cause the RNA polymerase to set down at the correct specific promoter; however, … . A. they only do this under the proper circumstance B. they only function when activated C. they only function to do this when bound to the other RNA polymerase subunits to form the holoenzyme D. they require a helper factor known as sigma’ E. they require ATP and GTP to function

C. they only function to do this when bound to the other RNA polymerase subunits to form the holoenzyme

Which Streptomyces-derived antibiotic, directly poisons the RNA polymerase? A. rapamycin B. rifampin C. actinomycin D. erythromycin E. streptomycin

B. Rifampin

Where would one find all the RNA processing enzymes within a eukaryotic cell? A. in the nucleus, largely concentrated on the CTD tail of RNA polymerase II B. in the nucleolus, largely concentrated on the back of RNA polymerase I C. in the nucleolus, largely concentrated on the back of RNA polymerase III D. moving freely through the soluble part of the nucleus looking for an RNA to process E. sequestered along the inside of the nuclear envelope awaiting activation

A. in the nucleus, largely concentrated on the CTD tail of RNA polymerase II

What is a simple name for the structure assumed by the most common type of intron during the process of being spliced out of a nascent transcript? ## Footnote A. chain B. rod C. helix D. sheet E. knot F. propeller G. cloverleaf H. lariat

H. Lariat

What is a convenient term used to describe a double-stranded cytoplasmic 26-bp micrRNA? A. functional miRNA B. mature miRNA C. truncated miRNA D. diced miRNA E. immature duplex miRNA

E. Immature duplex miRNA

When an miRNA joins the RISC, what type of functional RNA is it (what does it do)? A. guide RNA B. enhancer RNA C. lnc RNA D. tRNA E. rRNA G. template RNA H. Telomeric RNA

A. A guide RNA

TBP serves as one focal area of an important basal transcription factor for RNA polymerase II, which factor is this? A. TFIIA B. TFIIB C. TFIIC D. TFIID E. TFIIE F. TFIIF G. TFIIG H. TFIIH

D. TFIID

What is the name for the type of transcriptional termination that depends on the function of a specific protein? A. hairpin termination B. sigma-dependent termination C. sigma-independent termination D. rho-dependent termination E. rho-independent termination F. promoter-dependent termination

D. rho-dependent termination

Can a nascent tRNA have an intron? A. never B. infrequently C. always D. only in bacteria

B. Infrequently

What is a simple name for each of the two regions in prokaryotic promoters that seem particularly important for sigma factor binding? A. the -70 and -35 elements B. the -80 and -40 element C. the -65 and -30 elements D. the -35 and -10 elements

D. the -35 and -10 elements

In the diagram above, which letter labels the 5’ end of the **template** strand? A. B. C. D. E.

If the branch A were mutated to a C in an intron, what would go wrong? A. that intron would not be spliced out B. that intron would be joined to the next intron C. the next exon would be lost D. a shortened protein would ultimately result

A. That intron would not be spliced out

What happens when an mRNA poly(A) tail is shortened to around 25 A’s? A. the mRNA is sequestered within the endoplasmic reticulum until needed again B. the mRNA is degraded from either the 5’ end (when de-capped) or 3’ end C. the 3’ end of the mRNA is covered by a ribosome and stored for later use D. the poly(A) binding protein degrades the molecule to ribonucleotides

B. The mRNA is degraded from either the 5' end (when de-capped) or 3' end

In what form is most of the rRNA transcribed by Polymerase I? A. one long transcript that is subsequently processed and cut into the shorter forms B. 3 separate RNAs pf varying lengths C. one long transcript from which tRNAs and other RNAs are cut out D. Polymerase I does not transcribe rRNA

A. One long transcript that is subsequently processed and cut into the shorter forms.

When investigators study the -35 and -10 elements of a bacterial promoter, they find that either a change in consensus sequence or an increase in the distance between the actual recognition boxes causes this promoter to behave more weakly (as it is used less often). What does this really reflect? A. the requirement for sigma factor binding B. the stability of DNA duplex as determined by base sequence C. the sequence requirements for the duplex melting function of RNA polymerase D. none of these make sense

A. The requirement for sigma fator binding.

How is the activity of an RNA polymerase II controlled and the post-transcriptional activities coordinated? A. the phosphorylation pattern of the CTD tail B. methylation of the leading subunit C. the length of the CTD tail D. ATP-mediated pathways E. cAMP-mediated pathways

A. The phosphorylation pattern of the CTD tail

During RNA synthesis the DNA template sequence **GGTA** will be transcribed to produce which of the following sequences? A. TACC B. CCAT C. UACC D. CCAU E. UAGC

C. UACC

The recognition sequence in the basal promoter of an eukaryotic gene reads TATAAAT. What name is it given? A. INR element B. BSR element C. TSH element D. GRE element E. TATA element

E. TATA element

Just as in DNA replication, an enzymatic activity must be expressed to get the process under way. What is this? A. topoisomerase activity B. primase activity C. polymerase activity D. helicase activity

D. Helicase Activity

What are the three types of mRNA-binding proteins that we are highlighting

CBC, EJC, and PABP

What is the start codon used by eukaryotic cells? 1. STP 2. ATP 3. ACC 4. UAG 5. UUA 6. AUG

F. AUG

How many ATP phosphates are used when an aminoacyl-tRNA-synthetase puts an amino acid onto a tRNA? 1. 1 2. 2 3. 3 4. 4 5. 5 6. 6

B. 2

When the ribosome is assembled, where is the AUG and the initiator tRNA positioned? A. in the A site B. in the P site C. in the E site D. on the A train E. in front of the ribosome (waiting for it to catch up)

B. In the P site

Which eukaryotic initiation factor directly positions the small ribosomal subunit and the initiator tRNA over the start codon during formation of the initiation complex? 1. IF-2-GTP 2. eIF-2-GDP 3. eIF-2-GTP 4. eIF-4E-GTP 5. eIF-4E-GDP 6. eIF-6E-GTP

C. eIF-2-GTP

What eukaryotic elongation factor performs the same role as prokaryotic EF-Tu-GTP? A. eIF-2 B. eIF-3 C. eEF-G D. eEF-1-GTP E. eEF-2-GTP F. eEFm7G

D. eEF-1-GTP

What eukaryotic elongation factor performs the same role as prokaryotic EF-G? A. eIF-2 B. eIF-3 C. eEF-G D. eEF-1-GTP E. eEF-2-GTP

E. eEF-2-GTP

What normally happens when a ribosome reaches a normally positioned nonsense codon? A. polyA-binding protein breaks the helix and releases the large subunit B. polyA-binding protein interacts with a eukaryotic release protein complex and the ribosome C. the exon junction complex returns to bind the mRNA and push the ribosome off D. the exon junction complex causes the ribosome to bind a second large subunit E. any amino acid is put onto the end of the chain as a variable and random event F. the ribosome is captured and never allowed to disassemble and leave

E. Any amino acid is put onto the end of the chain as a variable and random event.

What is the target for the ricin toxin? A. eEF-2 and its target tRNA B. eEF-1 and its target tRNA C. 18S rRNA and its mRNA binding site D. a base within the 28S rRNA that is crucial to its peptidyl transferase activity E. the eRF complex and its ability to terminate a protein chain

D. A base within the 28S rRNA that is curcial to its peptidyl transferase activity

If tRNAs function as adaptors pairing up codon to correct amino acid, then what functions to make sure these adaptors work accurately? A. the large ribosomal subunit B. the aminoacyl-tRNA synthetases C. the signal peptidase D. the U2 snRNP E the exon junction complex

B. The aminoacyl-tRNA synthetases

. In some detail, distinguish the action of puromycin at the ribosome from that of tetracyline.

Puromycin is structurally similar to the 3' end of Aminoacyl-tRNA, it binds to the A site and partisipates in peptide bonding. Peptidyl- Puromycin causes premature termination. On the other hand Tetracyclin specifically blocks the A site, so nothing can bind there.

What are the 3 STOP codons?

UAA, UAG, UGA

Among the surprises obtained by conducting in vitro protein synthesis was the finding that many resulting proteins were somewhat longer than expected. What do we *now* know this means?

The commoon presence of a precursor " polyprotein" that is proteolytically processed to produced product proteins

Most biophysicists still believe that most proteins will eventually be able to fold into their correct shape and become stable. Why then, do most new proteins in a cell get folded by chaperones or chaperonins?

Seem polypeptide chains need to be nurtured or receive a nudge or even wait for further modification. The chaperones either fold them or guide them along thier journey to maturity.

What is a great shorthand way of thinking about an “antibody” that is useful for understanding its normal function and commercial use? A. it is an enzyme with an important mission B. it is specific hybridization probe routinely used to measure DNA sequences C. it is a very specific hybridization probe routinely used to measure DNA sequences D. it is a very specific probe, but it is made of protein - “binds” rather than “hybridizes” – and more often targets protein regions than it does nucleic acid sequence E. none of these answers make any sense

D. it is a very specific probe, but it is made of protein - “binds” rather than “hybridizes” – and more often targets protein regions than it does nucleic acid sequence

Many students find that the image below reminds them a little of a Viking longboat sailing up a river. Try to envision what this cartoon is really trying to show you and then answer the questions below. * What is designated by the label A? * What is designated by the label B? * What is designated by the label C? * What is designated by the bent arrow carrying the label D? * What is designated by the label E?

* A portion of an mRNA strand * The small Ribosomal subunit * eIF-2-GTP * The A site * The initiatior amino acid Methionine

Use the Codon Table below to determine the amino acid sequence of the peptide encoded by: **AUG CCC UUU UAC AAA GGG GAG AAG UUU UAG**

Met-Pro-Phe-Tyr-Lys-Gly-Glu-Lys-Phe- (stop)

If a kinase modifies a tyrosine in a protein, this usually provides an important signal. What could the response be? A. this protein changes shape B. this protein binds to a new partner protein C. an enzyme becomes active and processes its substrate(s) D. an enzyme shuts down its processing of its substrate(s) E. all of these things could happen upon tyrosine phosphorylation

E. All of these things could happen upon tyrosine Phosphorylation

What does linking a palmitate to a cysteine within a protein frequently do? A. tethers the protein to a membrane B. causes the protein to move into the nucleus C. traps the protein within the mitochondria D. causes the protein to be secreted from the cell

A. Thethers the protein to a membrane

Attachment of a single ubiquitin to a protein often causes what to happen? A. protein moves to or from a membrane (often inside a vesicle) B. protein moves inside the nucleus C. protein becomes trapped inside a mitochondrion D. protein is targeted to the lysosomes

A. Protein moves to or from a membrane (often inside a vesicle)

Where does N-linked glycosylation take place? A. within the RER B. within the SER C. within the Golgi apparatus D. within the lysosomes E. within the mitochondria

A. Within the RER

Where does O-linked glycosylation take place? A. within the RER B. within the SER C. within the Golgi apparatus D. within the lysosomes E. within the mitochondria

C. Within the Golgi Apparatus

Which N-terminal amino acid is sometimes linked to a fatty acid chain to anchor it to a membrane? A. proline B. asparagine C. glutamine D. glutamate E. aspartate F. glycine

F. Glycine

What post-translational amino acid modification is critical to the formation of mature fibrillary collagen? A. carboxylation of glutamate B. hydroxylation of proline C. phosphorylation of threonine D. cross-linking of cysteine residues E. phosphorylation of serine

B. Hydroxylation of Proline

What is the general name given to the infectious protein that produces diseases such as Kuru or Creutzfeldt-Jacob Disease? A. huntingtinin protein B. scrapamine C. spermidine D. APb4 protein E. Tau protein F. prion protein G. Ion protein H. protein kinase A (PKA)

F. Prion Protein

What is the name of the enzyme that attaches a poly-ubiquitin protein chain to disordered proteins? A. protein kinase A (PKA) B. ubiquitin ligase C. proteosomal isomerase D. lysosomal cathepsin D

B. Ubiquitin ligase

Where are the “polyprotein precursors” proteolytically processed to produce multiple protein chains? A. within the RER B. wiwthin the SER C. within the Golgi apparatus D. within the secretory vesicles that bud off the Golgi apparatus E. outside the source cell after secretion

D. Within the secretory vesicles bud off the Golgi Apparatus

Where are the zymogens (enzyme precursors) proteolytically processed to produce mature digestive enzymes? A. within the RER B. wiwthin the SER C. within the Golgi apparatus D. within the secretory vesicles that bud off the Golgi apparatus E. outside the source cell after secretion

E. Outside the source cell after secretion

What do you get if you deaminate a cytosine? A. Adenine B. Thymine C. Uracil D. Hypoxanthine E. Guanine F. An AP Site

C. Uracil

What do you get if you deaminate 5-methylcytosine? A. adenine B. thymine C. uracil D. hypoxanthine E. guanine F. an AP site

B. Thymine

What do you get if you “depurinate” a adenosine phosphate residue in a DNA? A. adenine B. thymine C. uracil D. hypoxanthine E. guanine F. an AP site

F. An AP site

What is formed when you lose the pyrimidine base from a nucleotide residue within the DNA? A. adenine B. thymine C. uracil D. hypoxanthine E. guanine F. an AP site

F. an AP site

What do you call a mutagen that adds methyl or ethyl groups to bases? A. teratogen B. carcinogen C. misanthropic agent D. alkylating agent E. agent of chaos

D. Alkylating agent

What goes wrong with O⁶ –methylguanine? A. it spontaneously degrades B. it will now base-pair with T C. it will now base-pair with A D. it will no longer form a base-pair

B. It will now base-pair with T

What problem does benzopyrene cause when it attaches to a guanine? A. it distorts the double-helix & gets in the way B. it causes G to hydrogen bond with A C. it does not cause much in the way of a problem D. it stimulates oxidation of thymidine E. it cross-links thymines into dimers

A. It distorts the double-helix & gets in the way

What kind of damage eventually can result from the intercalating agents (things like acridine orange that slide in between the stacked base-pairs in the double helix)? A. insertions, deletions and frameshift mutations B. interstrand cross-linking C. intrastrand cross-linking D. transpositions E. inversions

A. Inserttions, deletions and frameshifts mutations

Will a high incidence of UV radiation cause breaks in DNA strands? A. yes, of course, UV is dangerous B. no, but it will cause pyrimidine dimers C. no, but it will cause base deletions D. no, it is more likely to oxidize a guanine

B. No, but it will cause pyrimidine dimers

Reactive oxygen species can arise from irradiation of cells. Where else do they routinely originate? A. from within mitochondria B. from breakdown of albumen C. television and computer screens D. infrared stove burners E. microwave ovens

A. From within mitochondria

DNA mutation changes the mRNA sequence **AUGUAUAAACAUUGA** into the sequence AUG**A**UAUAAACAUUGA What kind of mutation is this? A. conservative missense B. nonconservative missense C. silent D. nonsense E. non-stop F. frameshift mutation G. RNA processing site mutation

F. Frameshift mutation

DNA mutation changes the mRNA sequence **AUGUAUAAACAUUGA** into the sequence AUGUAUA**G**ACAUUGA What kind of mutation is this? A. conservative missense B. nonconservative missense C. silent D. nonsense E. non-stop F. frameshift mutation G. RNA processing site mutation

A. Conservative missense

DNA mutation changes the mRNA sequence **AUGUAUAAACAUUGA** into the sequence AUGUAUAAACA**C**UGA What kind of mutation is this? A. conservative missense B. nonconservative missense C. silent D. nonsense E. non-stop F. frameshift mutation G. RNA processing site mutation

C. Silent

DNA mutation changes the mRNA sequence **AUGUAUAAACAUUGA** into the sequence AUGUAUAAA**G**AUUGA**.** What kind of mutation is this? A. conservative missense B. nonconservative missense C. silent D. nonsense E. non-stop F. frameshift mutation G. RNA processing site mutation

B. Nonconservative missense

Dynamic gene mutations can give rise to: A. premature aging syndrome B. sickle-cell disease C. tandem repeat disorders D. hepatitis C E. chronic mylogenous leukaemia F. reciprocal translocations

C. Tandem Repeats disorders

What do all the “DNA excision repair” mechanisms have in common? A. use of methylation and hypomethylation B. hemimethylation C. detection of double-stranded damage D. sensing of helical dislocation E. excision of a span of single-stranded DNA that contains the damage

E. Excion of a span of single-stranded DNA that contains the damage

After MutH makes its nick, what type of enzyme comes in to excise DNA? A. DNA ligase B. an exonuclease C. an endonuclease D. polymerase

B. An exonuclease

A mutation in MSH2 or MLH1 is linked: A. hereditary nonpolyposis colorectal cancer B. increased incidence of autism C. Asperger’s syndrome D. Frederich’s ataxia E. Xeroderma pigmentosum

A. Hereditary nonpolyposis colorectal cancer

In which repair mechanism does the “Exi-endonuclease” make 2 cuts that surround the damage, while the XP family proteins then lift out the single-strand that has been cut free? A. proof-reading B. mismatch repair C. nucleotide excision repair D. homologous recombination end joining E. NHEJ

C. Nucleotide excision repair

Mutations in XP family genes gives rise to what disease? A. hereditary nonpolyposis colorectal cancer B. increased incidence of autism C. Asperger’s syndrome D. Frederich’s ataxia E. Xeroderma pigmentosum

E. Xeroderma Pigmentosum

What is it that a DNA glycosylase will cause? A. a double-stranded cut B. a single-stranded cut C. widespread panic D. a nick E. an AP site

E. An AP site

What is the one type of enzyme that shows up again and again to seal nicks in the DNA phosphodiester backbone? A. DNA polymerase I B. DNA polymerase II C. DNA polymerase III D. reverse transcriptase E. DNA ligase

E. DNA Ligase

What is attracted to the AP site? A. the AP endonuclease B. the AP exonuclease C. DNA polymerase D. DNA glycosylase E. DNA ligase

A. The AP endonuclease

What is needed in order to correctly repair a double-stranded break in the DNA duplex? A. homologous or complementary sequence from the homolgous chromosome B. homologous proteins to bridge the gap between nucleotides C. Active ATM protein D. functional BRCA1 and BRCA2 E. A + C + D

E. A+C+D

What is a disorder featuring a predisposition towards developing cancer and heightened sensitivity to radiation that derives from a mutated ATM? A. Ataxia telangiectasia B. Bloom Syndrome C. Frederich’s ataxia D. Nijmegen breakage syndrome

A. Ataxia telangiectasia

Following the specific cut made by the Exi-endonuclease in “Nucleotide Excision Repair,” what happens to release the damaged region of the single-strand? A. the Exi-endonuclease cuts the same strand again B. an exonuclease C. DNA polymerase D. DNA glycosylase E. DNA ligase

A. The Exi-endonuclease cuts the same strand again

After the AP *endo*nuclease has made its cut in “Base Excision Repair,” what happens to remove the DNA on either side of the AP site? A. nothing much; the repair is completed B. polymerase inserts a new stretch of dNTP’s C. DNA ligase seals the gap D. an XP family protein lifts off the single strand E. a general *exo*nuclease sits down in the site and digests out a length of single-stranded DNA

E. A general exonuclease sits down in the site and digests out a length of single-stranded DNA