sequencing only - part 1 & 2 (ppt + video notes) Flashcards
Training Outline – Part 1/2
Library Construct
QC Steps – Qubit, qPCR, and Fragment Analyzer
Sample Requirements and Sample QC
Sequencing Platforms + Sequencing Workflows
Data Calculations
library structure
5’ to 3’ end
in order: P5 oligo (required), index 2 (optional), read 1 primer (required), insert DNA (required), read2 primer (required), index 1 (required), p7 oligo (required)
The order of the elements in library should be the same as it in the picture above.
* If not, the client should provide the library structure for us to evaluate and take all the risk.
P5 and P7 Oligos are used for binding to the FC (what is FC?)
They should be exactly the same as our sequences:
P5 Oligo: AATGATACGGCGACCACCGAGATCTACAC
P7 Oligo: ATCTCGTATGCCGTCTTCTGCTTG
- So here’s a library construct just to go through it 5 prime to three prime
- It’s got directionality and it’s also, it also has different components.
- So at the ends you’ll see we have the P5 and P7. these will bind to the flow cell
- 3:18
And so these are standard sequences that all alumina compatible libraries will have. - 3:22
If you don’t have the P5P7, your library won’t bind and it’ll get washed off in that first cycle. - 3:29
Right adjacent to the P5 and P7 you have index one and index 2. - 3:33
So index one is also commonly referred to as I7 because it’s adjacent to the P7 and then the P5. - 3:41
The index 2 is commonly referred to as the I-5 just because it’s right next to the P5. - 3:47
Now with these high throughput sequencers, we have lots and lots of samples not only going on the flow cell, but the individual lanes. - 3:57
And not a client may occupy the entire lane, but they also may not have a data requirement that matches the entire output of a lane. - 4:07
So they might buy a part of a lane. - 4:08
And so you’re going to have either multiple client samples going on the same lane or a client that has multiple samples going on the same lane. - 4:16
And so the only way to sort of piece out the different data sets from each respective sample is to have these barcodes or indexes attached. - 4:23
So as long as you’ve got more than one sample going on a lane, you’re going to have an index one or an I7, then that’s why it’s required. - So you can have a sequence on one side, which is a single index library where you’re just going to have that I7I5, sorry, index one I7, but you could also have a sequence on the opposite end, index 2 or the I-5.
- 4:48
And so by having more sequences or combinations available, you essentially have more options for how many samples can go on a lane, but a little bit more about that in training. - 4:57
The part three, I guess at this point, but you need to have at least one single index is what we call it. - 5:03
If you’ve got both, they’re called dual index libraries. - 5:06
And then within the dual index libraries or the dual indexing method, there’s a few variants that you can add as well. - 5:13
And then right adjacent to that, you’ve got the read 1 primer and the read 2 primer. - 5:18
So in order to attach these bases, you need that three prime overhang.
5:22
Those come in from the primers.
5:24
And so by having the sequencing primer binding sites, you can actually attach bases that are detected through fluorescence and know which base is added at which position.
Sample QC Process
Library volume (μL) : micropipetor
Con.(ng/μL) : Qubit
Fragment size (bp) : Fragment Analyzer
Molarity (nmol/L) : qPCR
sample receiving to qubit to fragment analyzer to qPCR to library QC report
qubit
A Qubit is used to obtain a concentration (ng/ul) by using a selective dye, which will bind to dsDNA (similar to Qubit assay used for WGS)
There are different kits used for quantification (based off what you would like to measure and amount available) – we use the Qubit™ dsDNA HS Kit.
This value gives us a reference point for comparison (will make more sense later in the presentation)
Keep in mind that it will not 100% bind to dsDNA (no assay/technique is ever 100% perfect in science – there might be nonspecific binding, which could impact the concentration provided by the Qubit.
Overall, this is still a good assay/technique for measuring concentration for a specific nucleic acid/marker.
Nanodrop vs Qubit
Some clients may not have access to a Qubit for quantification and may use a Nanodrop to obtain a concentration
Although this is not the most accurate – it is still acceptable for an initial check – keeping in mind, the Qubit derived concentration most likely will be lower
Why?
Nanodrop is a spectrophotometer, which will use the principle of absorbance: nucleic acids will have a peak absorbance at ~260nm.
Other contaminates within the sample may absorb near this value – which can throw off the quantification
Nandrop vs Qubit
Acceptable for a ‘quick check’ but need to keep in mind, most likely higher than the actual concentration.
sample A:
- 10ul with nanodrop concentration: 10ng/ul
- 10ul with qubit concentration: 6ng/ul
qPCR (quantitative PCR)
Based off a popular lab technique, PCR (polymerase chain reaction) but instead of
Being used to amplify a particular target/amplicon, it holds a quantitative goal.
Involves primers binding to specific targets within a product, which in turn yields a concentration
A great tool to measure the concentration of an Illumina library, which contains a highly specific/conserved sequence -> P5 and P7 regions.
Dyes (i.e. SYBR® Green)
will bind to the PCR product, providing
a florescence signal for detection by the
machine. Once threshold is met (Ct value),
these values can be compared against a standard
curve to yield concentrations.
qPCR (quantitative PCR)
Kit we use for qPCR: KAPALibraryQuantification Kit
qPCR is the ‘gold standard’ for quantifying and pooling libraries; however,
it requires special equipment and time (qPCR set-up + run can take >1 hour.)
Most clients are not available (too expensive and takes too much time) to quantify their libraries
through qPCR -> so they may resort to Qubit
At the end -> qPCR will allow us to obtain a Nanomolar (nM)
Official Library QC Report - Example
lib qubit (ng/ul) - 1.86
qpcr mol (nmol/L) - 13.22
Quantifying Libraries: Method #1
Fragment Analyzer (or equivalent) and Qubit
(concentration in ng/ul)/(660g/mol x average library size in bp) x 10^6 = concentration in nM
if the concentration in ng/ul is higher (inflated) that will impact the resulting calculation
Easier/Quick – but not as accurate
Quantifying Libraries: Method #2
Kit we use for qPCR: KAPALibraryQuantification Kit
At the end -> qPCR will allow us to obtain a Nanomolar (nM)
‘Gold Standard’ but requires special equipment/more time
qPCR and Qubit
Purpose: To understand amount of library that is present (can understand a little about the library quality)
The Qubit will tell us how much ‘DNA’ is present in the sample but not all DNA is going to be library
(if a poor library construction is done, there might be DNA fragments that are not adapter ligated.)
The qPCR will use the p5/p7 regions, which are specific to an Illumina library, to understand amount of library present.
Comparing the qPCR and Qubit can give us an idea of if the sample we have received is mainly Illumina library (good) or fragments that don’t have the adapters ligated (which is bad).
It is important to load the appropriate amount of library on a sequencer, as this will impact cluster generation and ultimately the amount of data produced.
qPCR and Qubit
After converting Qubit to nM (using conversion formula)
Qubit > qPCR: some library fragments may not have adapter ligated.
Qubit < qPCR: there might be library fragments that are single-stranded due to accidental or intentional denaturation. Our Qubit assay only measures double stranded DNA (due to the kit we use).
Qubit ~ qPCR: sample present is mainly library
Why Quantification is Important – Method #1 (Qubit)
Client did a QC on their end – used Qubit + Bioanalyzer; visually
we can see there is other “stuff” in the tube, which can be primers, leftover
reagents, etc. which might cause the Qubit to provide a higher read
Volume: 10ul
Qubit: 3ng/ul
Converted Qubit -> 4.2 nM
Why Quantification is Important – Method #2 (qPCR)
The sample was submitted for Novogene – below are some of the QC metrics:
Volume: 10ul
Qubit: 3ng/ul
qPCR: 0.8nM
