Module 4 Practice Exam and Review Flashcards
1
Q
What role does RNA stability play in gene regulation?
List 3 types of RNA structural elements that can affect the stability of an RNA molecule in eukaryotic cells.
Explain how these elements act to influence RNA stability.
A
????
The stability of mRNA influences gene expression by affecting the amount of mRNA available to be translated. The stability of mRNA is affected by the 5′ cap, the poly(A) tail, the 5′ UTR, the coding section, and sequences in 3′ UTR.
- if RNA is unstable, it will be degraded and unable to use for translation –> amt of protein synthesized depends on amt of available mRNA
- stability controlled by 5’ cap, polyA tail, 5’ UTR, 3’ UTR, and coding region
2
Q
List 4 levels at which gene control can take place in eukaryotes.
A
????
Alteration of structure, transcription, mRNA processing, RNA stability, translation, Post-translational modification
3
Q
Define RNA silencing (or interference). Explain how siRNAs arise and how they potentially affect gene expression. How are siRNAs different from the antisense RNA mechanism?
A
???
defn: when siRNA binds to mRNA, stimulating mRNA degradation
- arise from cleavage of dsRNA to make small fragments of ss siRNA
- block gene expression by degrading mRNA before it can be translated
- antisense RNA binds to mRNA too, but physically prevents translation
Process in which cleavage of double-stranded RNA produces small interfering RNAs (siRNAs) that bind to mRNAs containing complementary sequences and bring about their cleavage and degradation.
siRNAs are produced by the cleavage and processing of double-stranded RNA. antisense RNA are small RNA molecule that base pairs with a complementary DNA or RNA sequence and affects its functioning.
RNA silencing is a form of posttranscriptional regulation of mRNA that involves a small interfering RNA molecule formed from the cleavage of double-stranded RNA.
siRNA’s can affect gene expression by binding to complementary sites in mRNA and marking the mRNA for deletion. Antisense RNA binds to the complementary mRNA sequence, keeping it from being transcribed.
RNAi is the formation of 21-25 nucleotide-long siRNAs by Dicer cleavage of double stranded mRNA molecules. These form the RNA-induced silencing complex. The RISC can affect gene expression by inhibiting translation of mRNAs that code for a specific target gene. Antisense RNA mechanism is when a small single strand of RNA binds to the complementary mRNA, physically blocking translation from occurring; RNAi literally chops up the mRNA to prevent translation.
siRNAs arise from transposons, mRNA, and viruses. They are first recognized by a dicer which cleaves the double stranded RNA into short interfering RNA molecules which bind to the RNA induced silencing complex (RISC) which unwinds the RNA. These RNA strands can then bind to complementry strands of RNA and slow their translation down significantly as well as target them for degredation.
antisense RNA:
An RNA molecule (synthesized in vivo or in vitro) with a ribonucleotide sequence that is complementary to part of an mRNA molecule.
4
Q
Frameshift mutations are caused by the ____ or ____ of one or more nucleotides in DNA.
A
insertion or removal
b,d
5
Q
a) No lactose present, no glucose present
b) Lactose present, no glucose present
c) No lactose present, glucose present
d) Lactose present, glucose present
A
off, high, off, off
6
Q
______ are complexes where, among other activities, a great deal of RNA degradation takes place.
A
P bodies
7
Q
Recent discoveries on causes of fragile-X syndrome, myotonic dystrophy, and Huntington disease indicate what type of genetic alteration?
A
!!??
not “trinucleotide repeats”
changes in trinucleotide repeats?
8
Q
When regions around genes become sensitive to the enzyme ______________ this is an indication that those regions are becoming ______________ active.
A
DNase I, transcriptionally
9
Q
The __________ stabilizes the 5’ cap, which must be removed before the mRNA molecule can be degraded from the 5’ end.
A
!!???
NOT Poly(A) tail
10
Q
Mutations which arise in nature, from no particular artificial agent are called
A
spontaneous mutations
11
Q
Which of the following is TRUE for both prokaryotic and eukaryotic gene expression?
A
RNA polymerase binds to the promoter region to begin transcription.
12
Q
In what part of the mRNA does degradation generally begin?
A
at the 5’ end with the removal of the methyl cap
13
Q
The lac repressor binds to:
A
lactose and DNA.
14
Q
__________ mutations produce new traits and are usually dominant.
A
Gain-of-function
15
Q
Riboswitches were first discovered in 2002 and have been found in…
A
In all of the listed organisms:
bacteria
archaea
plants
fungi
16
Q
Which of the following clusters of terms applies when addressing enhancers as elements associated with eukaryotic genetic regulation?
A
cis-acting, variable orientation, variable position
17
Q
Two formal terms used to describe categories of mutational nucleotide substitutions in DNA are called
A
transversions and transitions
18
Q
What is the difference between a missense mutation and a nonsense mutation?
A
missense mutation:
A mutation that changes a codon to that of another amino acid and thus results in an amino acid substitution in the translated protein.
nonsense mutation:
A mutation that changes a codon specifying an amino acid into a Termination codon, leading to premature termination during translation of mRNA.
19
Q
What is catabolite repression? How does it allow a bacterial cell to use glucose in preference to other sugars?
A
?????
catabolite repression =
The selective inactivation of an operon by a metabolic product of the enzymes encoded by the operon.
In catabolite repression, the presence of glucose inhibits (represses) the transcription of genes involved in the metabolism of other sugars.
Because the gene expression necessary for utilizing other sugars is turned off, only enzymes involved in the metabolism of glucose will be synthesized.
Operons that exhibit catabolite repression are under the positive control of catabolic activator protein (CAP).
For CAP to be active, it must form a complex with cAMP.
Glucose affects the level of cAMP.
The levels of glucose and cAMP are inversely proportional—as glucose levels increase, the level of cAMP decreases. Thus, CAP is not activated.
20
Q
Name 6 different levels at which gene expression might be controlled.
A
- Regulation of Transcription
- Regulation of Splicing and Processing.
- Regulation of Transport
- Degradation of mRNA
- Regulation of Translation
- Modification and Activity of Protein
(1) Alteration or modification of the gene structure at the DNA level.
(2) Transcriptional regulation.
(3) Regulation at the level of mRNA processing.
(4) Regulation of mRNA stability.
(5) Regulation of translation.
(6) Regulation by post-translational modification of the synthesized protein.
21
Q
Degradation of a eukaryotic mRNA is generally preceded by shortening of the _____________.
A
Poly(A) tail
22
Q
Mutations in the promoter region of the b-globin gene indicate that some areas are more sensitive than others. When mutations occur in consensus sequences (modular elements such as GC box, CAAT box, TATA box), transcription ________________.
A
decreases
23
Q
telomeres
A
highly repetitive DNA
24
Q
The __________ is a type of _________ protein that binds to a region of DNA in the promoter of a gene called the _________ and prevents transcription from taking place.
A
??!!
The REPRESSOR is a type of REGULATOR protein that binds to a region of DNA in the promoter of a gene called the OPERATOR and prevents transcription from taking place.
25
A constitutive gene is _______ regulated and is expressed ____________.
A constitutive gene is NOT regulated and is expressed CONTINUALLY.
26
A highly-methylated region of a chromosome that has become largely deactivated and can be seen as dense-regions when viewed using electron microscopy.
Heterochromatin
27
The following may be caused by mobile genetic elements except ________________
undergo mutation
28
An operon is controlled by a repressor. When the repressor binds to a small molecule, it binds to DNA near the operon. The operon is constitutively expressed if a mutation prevents the repressor from binding to the small molecule.
negative repressible
29
Nutritional mutations can be defined as
those mutations which do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium.
30
I = lac repressor gene;
Z, Y, A = lac operon structural genes;
P = lac promoter;
O = lac operator
I-----P-O--Z---Y--------A---
Which parts of the DNA region shown in the diagram encode proteins?
I, Z, Y, A
31
Insulators can block the effects of enhancers only when....
they lie between an enhancer and a promoter.
32
What is a mutation?
A change in the DNA sequence.
33
A _________ mutation changes a codon that specifies an amino acid into one that terminates translation.
nonsense
34
An example of a gene product encoded by a regulatory gene is
repressor protein
35
The following may be caused by mobile genetic elements:
activate a gene in which they reside
cause chromosome breaks
disrupt a gene
36
# Fill in the blanks in the “level of transcription” column of this table with: + for high levels of transcription, and – for minimal levels of transcription of the lac operon.
Consider regulation by both the lac repressor and CAP (catabolite activator protein). The strain is wild type, with no partial diploidy.
????
1. high glucose, no lactose: -
2. no glucose, high lactose: +
3. high glucose, high lactose: -
4. no glucose, no lactose: -
37
Over the past decade, the most significant finding in biology has been the identification of miRNAs and siRNAs and their role in regulating the development of many multicellular organisms. Briefly describe the 4 different ways these small RNAs influence gene expression.
???
- Cleavage of mRNA: mRNA is cleaved in the middle of the siRNA, then mRNA degrades
- Inhibition of translation: base pairs to mRNA inhibiting translation (complementary)
- Transcriptional silencing: alter the chromatin structure, for RITS, causes methylation of histones binding DNA more tightly
- Degradation of mRNA - degrades but does not require slicer (as in cleavage)
degrading mRNA: through slicer activity
inhibiting transcription: transcriptional silencing due to methylation of either histone proteins or DNA sequences
inhibiting translation: binding of complementary regions with the mRNA molecule by miRNAs to prevent translation (premature termination)
silence genes:slicer-independent mRNA degradation stimulated by miRNA binding to complementary regions in the 3' UTR of the mRNA
38
What are 3 ways in which gene regulation is accomplished by modifying the structure of chromatin?
??
(1) the modification of histone proteins
(2) chromatin remodeling
(3) DNA methylation.
39
A promoter that affects only genes that are on the same piece of DNA is ____-acting.
cis
40
Since the binding of the ______ to the ______ prevents it from binding to DNA by causing a conformational change in its structure, it is called an _______ protein.
inducer, repressor, allosteric
41
An insulator is also known as a ____________ .
boundary element
42
This term describes genetic elements that affect other elements only when they are located adjacent to them. For example, the operator has this effect on its structural genes.
Cis-acting
43
This process moves a nucleosome from the TATA box of a gene's promoter so that transcription can occur.
Chromatin remodeling
44
The _________ consists of modifications to histone proteins that affect the expression of DNA sequences.
histone code
45
The type of control illustrated by GAL4 in the control of genes for yeast galactose-metabolizing enzymes.
positive inducible
46
The lac repressor protein controls expression of the lac operon via _________ .
binding to the lac operator site to repress expression
47
Ultraviolet light causes pyrimidine dimers to form in DNA. Some individuals are genetically incapable of repairing some dimers at "normal" rates. Such individuals are likely to suffer from ______ .
xeroderma pigmentosum
48
A mutant E. coli strain, grown under conditions that normally induce the lac operon, does NOT produce ß-galactosidase. What is a possible genotype of the cells?
lacI+ lacP– lacO+ lacZ+ lacY+ lacA+
49
It is estimated that transposable elements compose approximately what percent of the human genome?
50
50
When referring to attenuation in regulation of the tryptophan operon, it would be safe to say that when there are high levels of tryptophan available to the organism
transcriptional termination is likely.
51
Which of the following is NOT true regarding the differences in mRNA between prokaryotic cells and eukaryotic cells?
In eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not coupled.
52
In the above diagram, if there is a mutation in P and I, which of the following is true?
These are mutations that are, respectively, cis and trans acting on lac operon expression.
53
Define gene regulation.
| What are 3 ways gene regulation can be controlled in a cell?
Verified Correct Answer:
Gene regulation is defined as the control of a gene’s transcript and its protein product.
It can be achieved by altering either the transcription of the gene, RNA level, the translation of the protein from that transcript, or by altering the structure of DNA such that transcription cannot occur.
54
What are the basic regulatory elements in a strand of DNA that allow for genes to be regulated?
Are these different in eukaryotes and prokaryotes?
If so, how?
Verified Correct Answer:
Promoters, Operators in prokaryotes.
Promoters, proximal promoter elements, enhancers, and silencers in eukaryotes.
Eukaryotic transcription is different in a few ways, most notable in that prokaryotic genes are transcribed as operons, while eukaryotic genes are not.
In addition, the Role of the Nucleosome is different in eukaryotic Transcription.
55
Why do extra copies of genes sometimes cause drastic phenotypic effects?
????
the expression of some genes is balanced with the expression of other genes;
the ratios of their gene products, usually proteins, must be maintained within a narrow range for proper cell function.
Extra copies of one of these genes cause that gene to be expressed at proportionately higher levels, thereby upsetting the balance of gene products.
56
___________act as intermediaries between _____________ and specific _____ sequences to modify chromatin structure and activate transcription.
transcriptional activators, chromatin remodeling complexes, DNA
57
The region of a protein that is capable of holding on to a particular nucleotide sequence in order to affect proper gene regulation.
DNA binding domain
58
A condition in which a gene or group of genes is expressed all the time.
constitutive
59
This is the region of a gene where RNA polymerase binds to initiate transcription.
promoter
60
The molecular nature of transposable elements was first understood in E. coli due to the simplicity of the E. coli genome.
Which of the following types of DNA contribute significantly to the genome complexity of other organisms?
LINES (long interspersed elements),
SINES (short interspersed elements),
LTR (long terminal repeat)
retrotransposons...
61
The process by which excessive numbers of a sex chromosome are corrected, often by methylating the X chromosome to form a Barr body.
Dosage compensation
62
An operon is controlled by a repressor. When the repressor binds to a small molecule, it is released from binding to DNA near the operon. The operon is never expressed if a mutation prevents the repressor from binding to the small molecule.
negative inducible
63
Name 2 mutagens which would be classified as base analogues.
5-bromouracil and 2-aminopurine
64
Regulatory proteins that bind DNA have common motifs that interact with sequences of DNA.
How do amino acids in DNA-binding proteins interact with DNA?
By forming hydrogen bonds with DNA bases
65
Where would the lac repressor be bound in a (nonmutant) E. coli cell that is growing in low glucose and high lactose?
The repressor would not be bound.
66
What modification neutralizes the charges on histones that promote ionic interaction with DNA?
acetylation
67
What is the function of cAMP in regulation of the lac operon?
It activates an activator protein.
68
After translation, eukaryotic proteins can be modified by
acetylation.
the addition of phosphate groups.
the removal of amino acids.
the addition of methyl groups.
[all of the above.]
69
A mutant E. coli strain, grown under conditions that normally induce the lac operon, does NOT produce ß-galactosidase. What is a possible genotype of the cells?
lacI+ lacP– lacO+ lacZ+ lacY+ lacA+
70
A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces HIGH AMOUNTS of ß-galactosidase. What is a possible genotype of the cells?
lacI+ lacP+ lacOc lacZ+ lacY+ lacA+
71
What are the differences between neutral mutations and silent mutations?
?????
neutral mutation: Changes the amino acid sequence of a protein but does not alter the function of the protein. A mutation with no immediate adaptive significance or phenotypic effect.
silent mutation: Alters a codon, but the codon still specifies the same amino acid.
72
Which of the following two molecules of DNA has the lower melting temperature?
Why?
AGTTACTAAAGCAATACATC
TCAATGATTTCGTTATGTAG
AGGCGGGTAGGCACCCTTA
TCCGCCCATCCGTGGGAAT_
??
the top one, A-T bonds are only made of 2 Hydrogen bonds compared to C-G bonds which are made of 3 Hydrogen bonds
73
The following table shows several bacterial strain lac operon genotypes (some are partial diploids).
Fill in the blanks in the “lactose absent” and “lactose present” columns in this table. (+) means significant levels of active ß-galactosidase enzyme can be detected. (–) means no significant levels of active ß-galactosidase enzyme. Label your answers: Lactose absent #1-6 and Lactose present #1-6
??
1. lacI+ lacP+ lacO+ lacZ+ lacY+
2. lacI+ lacP+ lacOc lacZ+ lacY+
3. lacI+ lacP+ lacOc lacZ– lacY+
4. lacIs lacP+ lacOc lacZ+ lacY+
5. lacI– lacP+ lacO+ lacZ+ lacY+ / lacI+
6. lacIs lacP+ lacO+ lacZ+ lacY+/ lac I+
```
1 - +
2 + +
3 - -
4 + +
5 - +
6 - -
```
74
Regulation of gene expression using siRNAs is found in
eukaryotes only
75
DNA methylation may be a significant mode of genetic regulation in eukaryotes.
Methylation refers to
addition of methyl groups to the cytosine of CG doublets
76
Which of the below is NOT true about the location of enhancers?
The position of the enhancer has no effect on gene regulation.
77
A mutation in the gene for the yeast regulatory protein GAL4 causes yeast to grow poorly on galactose. What is the function of GAL4?
It is a transcription activator for the galactose-digesting enzyme gene.
78
A class of mutations which results in multiple contiguous amino acid changes in proteins is likely to be the following
frameshift
79
It is possible for a repressor to negatively regulate the expression of an operon because
the repressor binding site overlaps the promoter site of the operon allowing it to physically block the binding of RNA polymerase.
80
Which of the following terms best characterizes catabolite repression associated with the lactose operon in E. coli?
positive control
81
siRNAs and miRNAs are produced by
the cutting and processing of double-stranded RNA by Dicer enzymes.
82
Transcriptional repression by methylation of DNA is most common in sequences called____________ islands.
cpG
83
Regions of chromosomes that are inactivated through methylation are termed this.
Heterochromatin
84
These are factors that need not be adjacent to the genes they control. An example would be the lac operon’s repressor protein.
Trans-acting
85
Parts of chromosomes that are not methylated for inactivation, but rather are less dense-staining and are likely active in transcription in the cell.
euchromatin
86
One type of mutation involves the replacement of a purine with a purine. What general term is associated with this mutational phenomena?
Transition
87
The _________ can be used to quickly screen chemicals for their ability to be mutagenic (and hence potentially carcinogenic).
??!!!
| not AMES test??
88
The following statements are true about the location of enhancers:
They can be found upstream of the transcription initiation site.
They can be found downstream of the promoter.
They can be found in introns.
They can be found 3’ of the polyadenylation site.
89
Explain 2 different ways that intragenic suppressors may reverse the effects of mutations.
???
producing a codon that specifies the same amino acid as that specified by the original codon
OR
suppressing a frameshift mutation.
90
List at least 2 different types of DNA repair and briefly explain how each is carried out.
????
Mismatch repair: Repairs replication errors that result from base-pair mismatches. Mismatch repair enzymes recognize distortions in DNA structure due to mispairing and detect the newly synthesized strand by lack of methylation. The distorted segment is excised and DNA polymerase and ligase fill in the gap.
Photoreactivation - removes thymine dimers caused by UV light and does so with the help of the photoreactivation enzyme (PRE) and blue light
Nucleotide-excision repair: Relies on repair enzymes to recognize distortions of DNA double-helix. These enzymes excise damaged regions by cleaving phosphodiester bonds on either side of the damaged region. Gap created is filled up by DNA polymerase and ligase.
91
What is the difference between positive and negative control?
What is the difference between inducible and repressible operons?
???
Positive transcriptional control requires an activator protein to stimulate transcription at the operon. In negative control, a repressor protein inhibits or turns off transcription at the operon.
An inducible operon normally is not transcribed. It requires an inducer molecule to stimulate transcription either by inactivating a repressor protein in a negative inducible operon or by stimulating the activator protein in a positive inducible operon.
Transcription normally occurs in a repressible operon. In a repressible operon, transcription is turned off either by the repressor becoming active in a negative repressible operon or by the activator becoming inactive in a positive repressible operon.
Positive: requires an activator protein (stimulate transcription at the operon)
Negative: requires repressor protein (turns off transcription at the operon)
Inducible operon: requires an inducer molecule to stimulate transcription either by inactivating a repressor protein in a negative inducible operon or by stimulating the activator protein in a positive inducible operon.
repressible operon: (Transcription normally occurs) transcription is turned off either by the repressor becoming active in a negative repressible operon or by the activator becoming inactive in a positive repressible operon.
92
What is the common influence of ultraviolet light on DNA? Note that simply stating "mutation" is not an acceptable answer.
???!!
NOT Dimer formation
NOT pyrimidine dimer
93
A catabolite-activating protein (CAP) exerts _____________ control over the lac operon.
positive
94
_______________ is also known as RNA silencing and posttranscriptional gene silencing.
RNA interference
95
The process of error correction of mismatched bases carried out by DNA polymerases is called
proofreading
96
A eukaryotic DNA sequence that affects transcription at distant promoters is called a(n) ________________.
Enhancer
97
gene-encoding sequence
unique-sequence DNA
98
Alternative splicing is known to be important in the regulation of
the mammalian SV40 virus.
99
E. coli lac operon control by lac I.
negative inducible
100
E. coli bacteria are placed into a medium containing glucose and lactose.
Which of the genes below do you expect to be turned on?
```
f-galactosidase
Lac I
Lac P
Permease
None of the above
```
None of the above
101
LINES differ from retrotransposons in that LINES:
do not contain LTRs.
102
In the absence of glucose and in the presence of galactose, several genes are activated to enable yeast utilize galactose. The key regulator(s) of the yeast GAL system is/are the _______ protein(s).
Gal80
Gal4
Gal3
All of the above
Gal80
Gal4
Gal3
[All of the above]
103
What is the function of allolactose in regulation of the lac operon?
inducer
104
After translation, eukaryotic proteins can be modified by
acetylation.
the addition of phosphate groups.
the removal of amino acids.
the addition of methyl groups.
all of the above.
acetylation.
the addition of phosphate groups.
the removal of amino acids.
the addition of methyl groups.
[all of the above.]
105
Explain why mutations in the lacI gene are trans in their effects, but mutations in the lacO gene are cis in their effects.
???
Explain why mutations in the lacI gene are trans in their effects, but mutations in the lacO gene are cis in their effects. The lacI gene encodes the lac repressor protein, which can diffuse within the cell and attach to any operator. therefore affecting the expression of genes on the same or different molecules of DNA. The lacO encodes the operator. The binding of the lac repressor to the operator affects the binding of RNA polymerase to the DNA and therefore only affects the expression of genes on the same molecule of DNA.
The lacI gene mutation is trans because it effects the operators on BOTH sides of the DNA strand, the superrepressor bind to BOTH operators and prevents transciption on both sides
The lacO gene is cis because this mutation only effects genes that it is connected to, so they only affect one side of the DNA strand
106
List the different types of chromosome mutations and define each one.
???
Duplication- part of chromosome doubled
Deletion- loss of a chromosome segment
Inversion- chromosome segment is turn 180 degrees
Translocation- movement of genetic material between nonhomologous chromosomes or w/in the same chromosome
Aneupoloidy: loss or gain of one or more chromosomes so that the chromosome number deviates from 2n or the normal euploid complement.
Polyploidy: Gain of entire sets of chromosomes so the chromosome number changes from 2n to 3n (triploid), 4n (tetraploid), and so on.
Note- Chromosome mutations deal with large scale mutations that affect the structure or number of chromosomes
107
Why do insertions and deletions often have more drastic phenotypic effects than base substitutions do?
??
Base subs do not alter the reading frame. A single base change will only ater the amino acid that codon translates to. Insertion and deletions alter the frame causing the change of amino acids in every codon in every codon downstream causing drastic effects.
108
Apurinic (and apyrimidinic) sites (AP sites) involve a spontaneous loss of ______________ in an intact double-helix DNA molecule
???!!
NOT purine
A purine??
109
Proteins that affect chromatin structure without altering histone chemical structure are called _______________.
???!!
NOT chromatin remodeling complexes
Maybe chromatin-remodeling complexes
110
This structure forms when an extra X chromosome is methylated and largely inactivated.
It is most commonly found in females.
Barr body
111
mRNAs are degraded by enzymes called ____________.
ribonucleases
112
Mutations in the lacI and lacO genes in the lactose system often lead to full production of the 3 structural genes related to the lac operon even with no lactose available to the organism. Such mutations would be called________.
constitutive
113
What symbols are used to describe constitutive mutations in the lac operon?
???!!
NOT lacOc; lacOc, laclc
Maybe? I-, O^C
The answer that's technically true: I-, Oc
114
What is the function of cAMP in regulation of the lac operon?
It activates an activator protein.
115
When referring to attenuation in regulation of the tryptophan operon it would be safe to say that when there are high levels of tryptophan available to the organism
transcriptional termination is likely.
116
An example of a gene product encoded by a regulatory gene is
repressor protein.
117
A mutation in the gene for the yeast regulatory protein GAL4 causes yeast to grow poorly on galactose. What is the function of GAL4?
It is a transcription activator for the galactose-digesting enzyme gene.
118
Which of the following is TRUE for both prokaryotic and eukaryotic gene expression?
RNA polymerase binds to the promoter region to begin transcription.
119
The table below lists several genotypes associated with the lac operon in E. coli. For each, indicate with a "+" or a "-" whether β-galactosidase would be expected to be produced. (Note: you are analyzing whether or not you see functional β-galactosidase enzyme or not). Please label your answer No Lactose #1-4 and With Lactose #1-4.
????!!
β-galactosidase production.....
No Lactose
-, +, +, +
With Lactose
+, +, +, +
120
Describe some important differences between bacterial and eukaryotic cells that affect the way in which genes are regulated.
????
Prokaryotes: genes are clustered in operons and expressed through single mRNA, RNA polymerase is either blocked or stimulated by regulatory proteins, no chromatin structure
Eukaryotes: genes are separate with own promoter and transcribed on individual mRNA, initiation requires RNA pol, general transcription factors and activators, chromatin remodeling necessary for transcription
a. Bacterial genes organized into operons, while Eukaryotic genes are not organized into operons and are transcribed from its own promoter.
b. In eukaryotic cells, DNA must be unwound from histone proteins prior totranscription occurring.
c. In eukaryotic cells, activators are more common than in bacterial cells.
d. In bacteria, transcription and translation can occur concurrently. In eukaryotes,the nuclear membrane separates transcription from translation (greater diversity)
121
It is estimated that transposable elements compose approximately what percent of the human genome?
50%
122
What is the function of allolactose in regulation of the lac operon?
inducer
123
Name 2 mutagens which would be classified as base analogues.
5-bromouracil and 2-aminopurine
124
Insulators can block the effects of enhancers only when
they lie between an enhancer and a promoter.
125
When siRNAs or miRNAs are present, the rate of mRNA degradation_____________ , and the rate of protein production ___________.
increases, decreases
126
One type of mutation involves the replacement of a pyrimidine with a purine.
What general term is associated with this mutational phenomena?
transversion
127
The ____________, which binds to a core promoter, consists of general transcription factors and RNA polymerase.
Basal transcription apparatus
128
Transposable elements are also known as:
Jumping genes
| Mobile genetic elements
129
What human condition is caused by the inability to repair UV-induced DNA lesions?
Xeroderma pigmentosum
130
The general term for a non-polymerase protein that binds to an operator.
Repressor
131
The diagram below shows a chromosomal inversion around a gene. The arrows show how the gene will become physically turned around after mutation. Assuming there is a distinct mutant phenotype, describe in detail the type of mutation, including whether it should be dominant or recessive. Would this phenotype have the same effect in a haploid creature as opposed to a diploid one?
CORRECT ANSWER:
The diagram shows that the promoter for a gene will be moved from a region that enhances transcription toward one that acts as a silencer. This would likely be a loss-of-function mutation for that allele. In a diploid organism this may be recessive, providing the wild-type gene provides enough information. In a haploid organism, the dominant-recessive relationship is essentially meaningless except in the zygote.
132
Fill in the blanks in the “strain genotype” column of the following table. Write chromosomal genotypes with no partial diploidy. (+) means transcription of the lac operon. (–) means no transcription of the operon. The first line is filled in for reference. Please label your answers 1-3. Include the strain genotype for lacI, lacP, lacO, lacZ, and lacY
????
1.
Lactose absent: –
Lactose present: +
lacI+, lacP+, lacO+, lacZ+,lacY+
2.
Lactose absent: +
Lactose present: +
lacI+, lacP+,lacOc, lacZ+, lacY+
3.
Lactose absent: –
Lactose present: –
lacIs, lacP+, lacO+, lacZ+, lacY+
133
List at least two different types of DNA repair and briefly explain how each is carried out.
???
Mismatch repair: Repairs replication errors that result from base-pair mismatches. Mismatch repair enzymes recognize distortions in DNA structure due to mispairing and detect the newly synthesized strand by lack of methylation. The distorted segment is excised and DNA polymerase and ligase fill in the gap.
Photoreactivation - removes thymine dimers caused by UV light and does so with the help of the photoreactivation enzyme (PRE) and blue light
Nucleotide-excision repair: Relies on repair enzymes to recognize distortions of DNA double-helix. These enzymes excise damaged regions by cleaving phosphodiester bonds on either side of the damaged region. Gap created is filled up by DNA polymerase and ligase.
134
What is the difference between positive and negative control? What is the difference between inducible and repressible operons?
???
135
An insulator is also known as a(n) ________________ .
boundary element
136
A _________ mutation changes a codon that specifies an amino acid into one that terminates translation.
nonsense
137
An operon is controlled by a repressor. When the repressor binds to a small molecule, it binds to DNA near the operon. The operon is constitutively expressed if a mutation prevents the repressor from binding to the small molecule.
negative repressible
138
E. coli lac operon control by lac I
negative inducible
139
Which of the following terms best characterizes catabolite repression associated with the lactose operon in E. coli?
positive control
140
Choose the type of control illustrated by GAL4 in the control of genes for yeast galactose-metabolizing enzymes.
positive inducible
141
siRNAs and miRNAs are produced by
the cutting and processing of double-stranded RNA by Dicer enzymes.
142
Indicate the level of activity of the lac operon under the medium conditions listed below:
a) No lactose present, no glucose present
b) Lactose present, no glucose present
c) No lactose present, glucose present
d) Lactose present, glucose present
off, high, off, off
143
Explain 2 different ways that intragenic suppressors may reverse the effects of mutations.
Intragenic suppressors can change a second nucleotide in the same codon altered by the original mutation, producing a codon that produces the same amino acid as the original, unmutated codon.
They could also suppress a frameshift mutation by adding a single base elsewhere in the gene to restore the original reading frame.
144
Describe the lac operon and how it controls the metabolism of lactose.
The lac operon consists of 3 structural genes involved in lactose metabolism: the lacZ, lacY, and lacA genes.
Each of these 3 genes has a different role in the metabolism of lactose.
The lacZ gene codes for the enzyme beta-galactosidase, which breaks the disaccharide lactose into galactose and glucose, and converts lactose into allolactose.
The lacY gene, located downstream of the lacZ gene, codes for lactose permease. Permease is necessary for the passage of lactose through the E. coli cell membrane.
The lacA gene, located downstream of lacY, encodes the enzyme thiogalactoside transacetylase whose function in lactose metabolism has not yet been determined.
All of these genes share a common overlapping promoter and operator region.
Upstream from the lactose operon is the lacI gene that encodes the lac operon repressor. The repressor binds at the operator region and inhibits transcription of the lac operon by preventing RNA polymerase from successfully initiating transcription.
When lactose is present in the cell, the enzyme beta-galactosidase converts some of it into allolactose.
Allolactose binds to the lac repressor, altering its shape and reducing the repressor’s affinity for the operator. If the repressor does not occupy the operator, RNA polymerase can initiate transcription of the lac structural genes from the lac promoter.
145
What is catabolite repression? How does it allow a bacterial cell to use glucose in preference to other sugars?
In catabolite repression, the presence of glucose inhibits or represses the transcription of genes involved in the metabolism of other sugars. Since the gene expression necessary for utilizing other sugars is turned off, only enzymes involved in the metabolism of glucose will be synthesized. Operons that exhibit catabolite repression are under the positive control of catabolic activator protein (CAP). For CAP to be active, it must form a complex with cAMP. Glucose affects the level of cAMP. The levels of glucose and cAMP are inversely proportional—as glucose levels increase, the level of cAMP decreases. Thus, CAP is not activated.
146
What is attenuation? What is the mechanism by which the attenuator forms when tryptophan levels are high and the antiterminator forms when tryptophan levels are low?
Attenuation is the termination of transcription prior to the structural genes of an operon. It is a result of the formation of a termination hairpin or attenuator.
2 types of secondary structures can be formed by the mRNA 5' UTR of the trp operon. If the 5' UTR forms two hairpin structures from the base pairing of region 1 with region 2 and the pairing of region 3 with region 4, then transcription of the structural genes will not occur. The hairpin structure formed by the pairing of region 3 with region 4 results in a terminator being formed that stops transcription. When region 2 pairs with region 3, the resulting hairpin acts as an antiterminator allowing for transcription to proceed. Region 1 of the 5' UTR also encodes a small protein and has two adjacent tryptophan codons (UGG).
Tryptophan levels affect transcription due to the coupling of translation with transcription in bacterial cells. When tryptophan levels are high, the ribosome quickly moves through region 1 and into region 2, thus preventing region 2 from pairing with region 3. Therefore region 3 is available to form the attenuator hairpin structure with region 4, stopping transcription. When tryptophan levels are low, the ribosome stalls or stutters at the adjacent tryptophan codons in region 1. Region 2 now becomes available to base pair with region 3, forming the antiterminator hairpin. Transcription can now proceed through the structural genes.
147
What is antisense RNA? How does it control gene expression?
Antisense RNA molecules are complementary to other DNA or RNA sequences.
In bacterial cells, antisense RNA molecules can bind to a complementary region in the 5' UTR of a mRNA molecule, blocking the attachment of the ribosome to the mRNA and thus stopping translation.
148
What changes take place in chromatin structure and what role do these changes play in eukaryotic gene regulation?
Changes in chromatin structure can result in repression or stimulation of gene expression.
As genes become more transcriptionally active, chromatin shows increased sensitivity to DNase I digestion, suggesting that the chromatin structure is more open. Acetylation of histone proteins by acteyltransferase proteins results in the destabilization of the nucleosome structure and increases transcription as well as hypersensitivity to DNase I.
The reverse reaction by deacetylases stabilizes nucleosome structure and lessens DNase I sensitivity. Other transcriptional factors and regulatory proteins, called chromatin remodeling complexes, bind directly to the DNA, altering chromatin structure without acetylating histone proteins. The chromatin remodeling complexes allow for transcription to be initiated by increasing accessibility to the promoters by transcriptional factors.
DNA methylation is also associated with decreased transcription. Methylated DNA sequences stimulate histone deacetylases to remove acetyl groups from the histone proteins, thus stabilizing the nucleosome and repressing transcription. Demethylation of DNA sequences is often followed by increased transcription, which may be related to the deacetylation of the histone proteins.
149
Briefly explain how transcriptional activator proteins and repressors affect the level of transcription of eukaryotic genes.
Transcriptional activator proteins stimulate transcription by binding DNA at specific base sequences (such as an enhancer or regulatory promoter) and attracting or stabilizing the basal transcriptional factor apparatus.
Repressor proteins bind to silencer sequences or promoter regulator sequences. These proteins may inhibit transcription by either blocking access to the enhancer sequence by the activator protein, by preventing the activator from interacting with the basal transcription apparatus, or by preventing the basal transcription factor from being assembled.
150
What is an insulator?
An insulator or boundary element is a sequence of DNA that inhibits the action of enhancers (regulatory elements) in a position dependent manner.
151
What role does RNA stability play in gene regulation? What controls RNA stability in eukaryotic cells?
The total amount of protein synthesized is dependent on how much mRNA is available for translation. The amount of mRNA present is dependent on the rates of mRNA synthesis and degradation. Less stable mRNAs will be degraded and become unavailable as templates for translation.
The presence of the 5' cap, the 3' poly(A) tail, the 5' UTR, the 3' UTR, and the coding region in the mRNA molecule affects stability.
Poly(A) binding proteins (PABP) bind at the 3' poly(A) tail. These proteins contribute to the stability of the tail, and protect the 5' cap through direct interaction. Once a critical number of adenine nucleotides have been removed from the tail, the protection is lost and the 5' cap is removed. The removal of the 5' cap allows for 5' to 3' nucleases to degrade the mRNA.
152
Define RNA silencing.
| Explain how siRNAs arise and how they potentially affect gene expression.
RNA silencing, or RNA interference, occurs when double-stranded RNA molecules are cleaved and processed to produce small single-stranded interfering RNAs (siRNAs). These siRNAs bind to complementary sequences in mRNA molecules, stimulating cleavage and degradation of the mRNA.
The siRNAs may also stimulate DNA methylation at DNA sequences complementary to the siRNAs.
The paired mRNA-siRNA attracts a protein-RNA complex that cleaves the mRNA in an area bound by the siRNA. Following the initial cleavage, the mRNA is further degraded. The cleavage and subsequent degradation of the mRNA make it unavailable for translation.
DNA methylation in the nucleus stimulated by siRNAs also affects transcription.
153
Compare and contrast bacterial and eukaryotic gene regulation. How are they similar? How are they different?
Bacterial and eukaryotic gene regulation involves the action of protein repressors and protein activators. Cascades of gene regulation in which the activation of one set of genes affects another set of genes take place in both eukaryotes and bacteria. Regulation of gene expression at the transcriptional level is also common in both types of cells.
Bacterial genes are often clustered in operons and are coordinately expressed through the synthesis of a single polygenic mRNA. Eukaryotic genes are typically separate with each having its own promoter and transcribed on individual mRNAs. Coordinate expression of multiple genes is accomplished through the presence of response elements. Genes sharing the same response element will be regulated by the same regulatory factors.
In eukaryotic cells, chromatin structure plays a role in gene regulation. Chromatin that is condensed inhibits transcription. So, for expression to occur, the chromatin must be altered to allow for changes in structure. Both acetylation of histone proteins and DNA methylation are important in these changes.
At the level of transcription initiation, the process is more complex in eukaryotic cells. In eukaryotes, initiation requires a complex machine involving RNA polymerase, general transcription factors, and transcriptional activators. Bacterial RNA polymerase is either blocked or stimulated by the actions of regulatory proteins.
Finally, in eukaryotes the action of activator proteins binding to enhancers may take place at a great distance from the promoter and structural gene. These distant enhancers occur much less frequently in bacterial cells.
154
Explain why mutations at the lacI gene are trans in their effects, but mutations in the lacO gene are cis in their effects.
The lacI gene encodes the lac repressor protein, which can diffuse within the cell and attach to any operator. It can therefore affect the expression of genes on the same or different molecules of DNA.
The lacO gene encodes the operator. It affects the binding of DNA polymerase to the DNA, and therefore affects only the expression of genes on the same molecule of DNA.
