EXAM 2 QUESTIONS Flashcards by Solrac Nauj

Name at least 4 structural predictions made by Watson/Crick DNA model.

Base pairs were complementary

The structure formed a Double Helix

The helix was Right-handed

A pairs with T; G pairs with C

The diameter of DNA is 20 Angstroms.

Base pairs are perpendicular to the strands and lie flat.

The strands are antiparallel, where one runs from 3’-5’ and the other 5’-3’.

How well did you know this?

Not at all

Perfectly

What are the 3 classes of “functional” (non-mRNA) RNAs?

Briefly describe the role of each class of functional RNA.

tRNA: brings the correct amino acid to the mRNA during translation

rRNA: major component of ribosomes

snRNA: helps process RNA transcripts (especially, helps remove introns).

How well did you know this?

Not at all

Perfectly

Discuss the experimental evidence for the semi-conservative replication of DNA determined by in vitro experiments in the bacteria E.Coli.

The scientist started with heavy N-15 DNA, and allowed it to mix with the light N-14 DNA.
The first round of replication yielded identical DNA strands that had one full parent N-15 strand and one new N-14 strand.
These results ruled out the possibility of conservative replication because they were hybrids.
One more trial was needed to rule out the dispersive model of replication.
The second round yielded light-heavy DNA hybrids and light DNA (14/15-N and 14-N).
These results ruled out the dispersive model because the dispersive model would have only yielded hybrids.

How well did you know this?

Not at all

Perfectly

Briefly state and describe the 4 primary ingredients that, along with DNA polymerase I, are needed for the in vitro system.
Buffering, temperature, and nonspecific ion concentrations are conditions, not ingredients.

!!!!???

Taken, in part, from Module 2.2 lecture.

DNA primers/template with partial complement:
strand of nucleic acid that serves as a starting point for DNA synthesis

-dNTPs:
The building blocks for new strands are deoxyribose nucleoside triphosphates (A,T,C, or G)

-MgCl2: (or Mg++)
part of the active site. It helps bind the nucleotides which the DNA polymerase uses to copy the template strand and join to make new DNA

-Phosphate source:
The phosphate bonds to the nucleotide triphosphates and provides the energy

How well did you know this?

Not at all

Perfectly

Kornberg used the phage PhiX174 to demonstrate DNA pol 1 was able to produce biologically active DNA in vitro.

Describe in sufficient detail the experimental methods that he used to draw the conclusions in DNA pol 1 could produce biologically active DNA.

The last part comes directly from slides.

The phage would insert the (+) form of its genetic information inside the host. The host would make (-) copies. (+) form phages would leave the cell to do it again. Pol I, and no other polymerase was present, but translation occurred accurately.

Single stranded circular DNA (+) strand infects E. coli.
The (+) strand directs replication of the (-) strand in E. coli, resulting in double-stranded duplex or replicative form (RF).
(+) strands are produced and packaged into viral coats to form mature virus particles.
Final (+) strand of øX174 infected E. coli and produced infectious mature phage particles.
DNA replication was accurate; any alteration the bases of øX174 would have probably rendered it non-viable.

How well did you know this?

Not at all

Perfectly

What are 3 ways that miRNA can influence gene expression?

miRNA….

Represses translation,
Triggers mRNA degradation,
Represses transcription of specific genes and larger regions of the genome using
RITS.
Works with RITS for chromatin remodeling and transcriptional silencing.
miRNA has a role in splicing, and it can get mRNA destroyed. It works with snRNA to regulate mRNA.

correct answer, got from TA:

degrades mRNA
condenses chromatin
prevents processing of ribosome

How well did you know this?

Not at all

Perfectly

What experimental methods led Avery, McCarthy, & Macleod to determine that DNA was the “transforming material” in their classic experiments?

They introduced enzymes to the mixtures to degrade one component at a time and see if the genetic material was still passed on or not.
If the genetic material passed to the next generation, then the substance that the enzyme degraded was not the transforming material.
RNAse, for example, was introduced to remove all RNA; the genetic material still passed on, so RNA could not be the genetic material.
DNAse removed all DNA, and no genetic information passed on, so the scientists knew that DNA held the genetic information.

They performed an experiment where they took a large sample of IIIS, centrifuged, and heat killed it.
After that they excised and removed the proteins, carbohydrates, and lipids.
When joined to the active substrate IIR, transformation occurred.
They then treated with protease to get rid of all the remaining protein.
Transformation still occurred proving that protein was not the transforming material.
They then treated with ribonuclease.
Transformation still occurred proving that RNA was not the transforming material.
Lastly. they treated with deoxyribonuclease (DNAse) to get rid of the DNA and no transformation occurred.
This proved that DNA was the transforming molecule.

How well did you know this?

Not at all

Perfectly

An organism has a A + T content of 50%.

What is the percentage for C?

25%

How well did you know this?

Not at all

Perfectly

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)?
Indicate the reason for your choice.

A:
GCATTAGGGCATCCC
CGTAATCCCGTAGGG

B:
TTAGCGTTATAGCAT
AATCGCAATATCGTA

DNA molecule A would be most difficult to separate, because it has a higher G-C content.

Molecules B has a higher A-T content.

DNA molecule A has a higher A-T content. However, G-C pairs are held together by three hydrogen bonds while A-T bonds are held together by 2 hydrogen bonds. Hence, a higher number of G-C pairs gives a double-stranded DNA a higher heat resistance.

How well did you know this?

Not at all

Perfectly

Match with best letter choice:

DNA Ligase

i, phosphodiester bonds at DNA nicks

How well did you know this?

Not at all

Perfectly

The 5’ cap on an mRNA is important fro all the purposes listed below, EXCEPT for the ___ of an mRNA molecule.

Transcription
Intron Removal
Stability
Initiation of Translation

Transcription

How well did you know this?

Not at all

Perfectly

While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to set up a condition where DNA polymerase can the take over for replication.

Primase

How well did you know this?

Not at all

Perfectly

This new strand of DNA has its 3’ end orientated in the Opposite direction as that in which the replication fork travels.

The lagging strand

How well did you know this?

Not at all

Perfectly

Assume the following pathway:

Precursor —> K —> C —> B —> Product

Mutations for 3 genes (genes I, II, and III) have been isolated that interrupt this pathway.

Addition of:
B rescues mutations in gene III
K, C, and B rescues mutations in gene II
C and B rescue mutations in gene I

In what order do genes I, II, and III function in this pathway?

II, I, III

How well did you know this?

Not at all

Perfectly

Matching terms:

Primase

synthesis of RNA primer

How well did you know this?

Not at all

Perfectly

Matching terms:

SSBP

stabilizing single-stranded DNA

How well did you know this?

Not at all

Perfectly

Matching terms:

Helicase

Unwinding DNA

How well did you know this?

Not at all

Perfectly

Matching terms:

Gyrase/Topoisomerase

Relieve tension in DNA due to supercoiling

How well did you know this?

Not at all

Perfectly

Matching terms:

DNA Polymerase III

initiate DNA synthesis

How well did you know this?

Not at all

Perfectly

Matching terms:

DNA ligase

connecting Okazaki frgments

How well did you know this?

Not at all

Perfectly

Matching terms:

DNA Polymerase I

Filling the gap left after primers are removed

How well did you know this?

Not at all

Perfectly

The ribosome is the primary site of

protein synthesis

How well did you know this?

Not at all

Perfectly

The anticodon on the tRNA molecule…

binds to the mRNA in a complementary fashion

How well did you know this?

Not at all

Perfectly

What is a gene?

A sequence of DNA that encodes a PROTEIN.

How well did you know this?

Not at all

Perfectly

How many nucleotides would be expected for a gene coding for a protein with 300 amino acids?

900

Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following, EXCEPT that genetic material must encode the phenotype. genetic material must replicate faithfully. genetic material must contain complex coding information genetic material must be composed of many different units to account for the variability seen in nature.

genetic material must be composed of many different units to account for the variability seen in nature. (this was not known before DNA was identified as the genetic material)

Which of the following statements is NOT true concerning RNA and DNA? a) RNA is more stable than DNA b) DNA is transcribed into RNA which is translated into protein c) DNA is permanent in a cell, RNA is temporary d) The sugar portion of RNA and DNA are different

RNA is more stable than DNA

In the DNA double helix, ...

A purine always pairs with a pyrimidine

What enzyme is exploited to produce synthetic mRNAs?

Polynucleotide phosphorylase

Cytosine makes up 28% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be Thymine?

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. What are some common consensus sequences?

CAAT, TATA

Translation is directly dependent on all of the following associations EXCEPT _______. a. complementary base pairing between mRNA and rRNA b. complementary base pairing between mRNA and tRNA c. association of the 30S and the 50S ribosomal subunits d. complementary base pairing between mRNA and DNA

complementary base pairing between mRNA and DNA

The basic structure of a nucleotide includes:

base, sugar, and phosphate

The Secondary structure of a protein includes the following elements:

alpha-helix and beta-pleated sheets

What are the 2 major components of the Tobacco Mosaic Virus?

RNA and protein

Introns are known to contain termination codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? Exons are spliced out of mRNA before translation These triplets cause frameshift mutations, but not termination More than one termination codon is needed to stop translation Introns are removed from mRNA before translation UAA, UGA, UAG are initiator codons, not termination codons

Introns are removed from mRNA BEFORE translation.

An intron is a section of _____

RNA that is removed during RNA processing.

How did the work of Hershey and Chase contribute to the model of DNA as the genetic material? EXTENDED RESPONSE

Hershey & Chase designed a series of experiments to determine whether phage protein or DNA is transmitted in phage replication. They used radioactive forms of phosphorus and sulfur to follow DNA and protein, respectively. When new phage progeny emerged, many emitted radioactivity from 32P, demonstrating that DNA had been passed on during reproduction. Hershey & Chase used bacteriophages to determine which material was replicated after infecting a host. Heavy phosphorus was used to label DNA in one sample, while radioactive sulfur was used to label the protein in the other. After infecting a host, the ghost phages were viewed to determine which label remained. The phages with labeled sulfur resulted in ghost phages with labeled sulfur, and the other sample’s had no label; indicating the material injected into the host was DNA, and therefore the genetic material.

Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes

excision of introns

Given the figure above, is it DNA or RNA? ____ . Is the arrow closest to the 5’ or 3’ end? _____ Spleen diesterase is an enzyme that breaks the covalent bond that connects the phosphate to the 5’ carbon. Assume that the dinucleotide is digested with spleen diesterase. To which base and to which carbon on the sugar is the phosphate now attached, A or T? _____. 3’ or 5’? _____ (pic of 2 rings attached to each other, top one is A, bottom is T, arrow pointing to bottom left C of bottom ring) A ---- T --> C

DNA 3' end A 3’

The genetic code is fairly consistent among all organisms. | The term often used to describe such consistency is

universal

To translate a mRNA you require two other RNAs. These are .....

tRNA and rRNA

Significant in the deciphering of the genetic code was the discovery of the enzyme Polynucleotide Phosphorylase. What was this enzyme used for?

The manufacture of RNA for cell-free systems.

You are provided a sample of human genomic dsDNA and told that adenine makes up 34% of the nucleotides in the sample. Approximately what percentage of the nucleotides in the sample will be guanine? ``` 8% 16% 34% 66% Given the size of the human genome, it would be impossible to determine the percentage asked for ```

16%

As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?

The tRNA that was in the A site moves into the P site

Explain at least two reasons why the following definition of a gene is inadequate: “A gene consists of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide.”

Because a gene can encode for more than one protein; the use of word “single” is too exclusive. Genes can be transcribed into multiple RNA molecules. RNA molecules can encode for more than one polypeptide

Below is a list of terms, each term relating to the replication of chromosomes. Describe the role/relationship of each in/to chromosome replication. Okazaki fragment Lagging strand Bidirectional

Okazaki fragments are segments of DNA synthesized along the lagging strand, in the 5’ to 3’ direction Lagging strand: the strand from which DNA is copied in segments due to the anti-parallel nature of DNA--the lagging strand has its 5’ end continually getting farther away from the replication fork. Bidirectional--when DNA replication occurs in both directions, counterclockwise and clockwise, from the origin of replication of circular DNA; two replication forks

An organism has a G content of 28%. What is the percentage for A?

An organism has a G content of 33%. | What is the percentage for A?

An organism has an A + T content of 60%. | What is the percentage for C?

An organism has an A + T content of 52%. | What is the percentage for C?

Short “bursts” of DNA synthesis on the lagging strand produce ______________.

Okazaki fragments

Assume the following pathway: Precursor ----> L ----> D ----> C----> Product Mutations for 3 genes (genes I, II, III) have been isolated that interrupt this pathway. ``` Addition of: L, D, C rescues mutations in gene III C rescues mutations in gene II D, C rescue mutations in gene I In what order do genes I, II, and III function in this pathway? ```

III, I, II

In an analysis of the nucleotide composition of double-stranded DNA to see which bases are equivalent in concentration, which of the following would be true? ``` A = C A = G and C = T A + C = G + T A + T = G + C Both B and C are true. ```

A + C = G + T

supercoil removal

DNA gyrase

RNA primer synthesis

primase

3’ → 5’ exonuclease activity

DNA polymerase I

lagging strand

Okazaki fragments

leading strand

continuous synthesis

phosphodiester bonds at DNA nicks

DNA ligase

bidirectional circular replication

theta replication

A particular triplet of bases in the template strand of DNA is 5’ AGT 3’. The corresponding codon for the mRNA transcribed is

3’ UCA 5’

When codons that code for the same amino acid differ in their _________, a single tRNA might bind both of them through wobble base pairing.

3’ base

Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon?

Differences in pre-mRNA splicing that results in an altered pattern of exon inclusion.

The role of tRNA is:

To act as transporters bringing amino acids to the site of protein synthesis.

Which is not true of amino acids? There are 20 of them required in the body They are the building blocks of proteins tRNA brings them to the ribosome for protein synthesis All of the above are true

All of the above are true

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation?

It bends and partially unwinds DNA at the promoter

This new strand of DNA has its 3’ end oriented in the same direction as the replication fork travels.

leading strand

Which of these sequences, if paired with its complementary strand, would be a palindrome? 5’ CCCCCC 3’ 5’ CCCGGG 3’ 5’ CTGCTG 3’ 5’ TCCCCT 3’

CCCGGG

Telomeres are:

special repeat sequences at the end of chromosomes

The primary structure of a protein is determined by

the sequence of amino acids.

Translation of RNA into protein takes place on which cellular organelle?

ribosome

Which enzyme catalyzes the elongation of DNA strand in the 5’ to 3’ direction?

DNA polymerase III

The spliceosome is a large enzyme that catalyzes the removal of specific ...

introns in pre-mRNAs

Heterochromatin is characterized by all of the following EXCEPT that it

contains genes that require high levels of transcription

Which statement is true regarding negative supercoiled DNA?

That negative supercoiled DNA is underrotated and allows for easier strand separation during replication and transcription

The Watson-Crick molecule can carry a vast amount of hereditary information due to which of its following properties?

long sequences composed of 4 different bases

The relationship between a gene and a messenger RNA is that ``` A) genes are made from mRNAs B) mRNAs are made from genes C) mRNAs make proteins, which then code for genes D) all genes are made from mRNAs E) mRNA is transcribed to DNA ```

mRNAs are made from genes

DNA carries negative charges on the phosphate groups, how can it then form a double helix (which brings those negative charges together)?

negative charges are masked by Cations in Aqueous solution

RNA differs from DNA in that it: | 3 ways

RNA has uracil rather than thymine RNA is usually single-stranded rather than double-stranded RNA has ribose sugars rather than deoxyribose sugars in its nucleotides

This molecule is synthesized using nucleotides containing the base adenine, guanine, cytosine and uracil: RNA only DNA only both RNA and DNA neither RNA or DNA

a. RNA only

The packaging of DNA into a confined space is what level of DNA structure?

tertiary

Which of these sequences could form a hairpin? 5’ GGGGTTTTCCCC 3’ 5’ AAAAAAAAAAAA 3’ 5’ ACACACACACAC 3’ 5’ TTTTTTCCCCCC 3’

5’ GGGGTTTTCCCC 3’

Which of these sequences could form a hairpin?

TTACGGCGGTTCCGCCGGTG | lots of GC bonds when folded is the key point

Which of the following best describes the addition of nucleotides to growing DNA chains? a nusing a molecule of pyrophosphate a nucleoside triphosphate attached to the 3’ end if the DNcleoside diphosphate attached to the 5’ end if the DNA, releaA, releasing a molecule of pyrophosphate a nucleoside triphosphate attached to the 5’ end if the DNA, releasing a molecule of pyrophosphate a nucleoside diphosphate attached to the 3’ end if the DNA, releasing a molecule of pyrophosphate

a nucleoside triphosphate attached to the 3’ end if the DNA, releasing a molecule of pyrophosphate

In each round of the elongation cycle of protein synthesis, a new ______binds to the codon in the _________-site, then the peptide is transferred from the tRNA in the ______ site to the new aminoacyl-tRNA, and finally the entire _____ moves along the mRNA in a 5’ to 3’ direction

aminoacyl-tRNA A P ribosome In each round of the elongation cycle of protein synthesis, a new __aminoacyl-tRNA__ binds to the codon in the __A-site, then the peptide is transferred from the tRNA in the __P-site to the new aminoacyl-tRNA, and finally the entire __ribosome__ moves along the mRNA in a 5’ to 3’ direction

The DNA replication enzyme that most closely resembles RNA polymerase is ``` Polymerase I Polymerase II primase telomerase helicase ```

Primase

The genetic code is said to be triplet, meaning that There are three amino acids per base in mRNA There may be three ways in which an amino acid may terminate a chain There are three bases in mRNA that code for an amino acid None of these answers There are three “nonsense” triplets

There are three bases in mRNA that code for an amino acid

1. DNA or RNA molecule? 2. Is the 3’ end at position I or II? The DNA strand that served as a template for the synthesis of this tetranucleotide was composed of the bases: 5’ ACAG 3’. Given this information, write the expected bases for this strand in the order w-z. 4. Assume the following procedure is conducted: The third phosphate from the top (circle) is labeled with 32P. The tetranucleotide is then digested with spleen dieterase, an enzyme that breaks the bond between the phosphate and the 5’ carbon group in nucleic acids. State which base among the breakdown products will be expected to be attached to the 32P. Enter w, x, y, or z.

1. DNA 2. II 3. 5’ CTGT 3’ 4. X because it will break the bond between the labeled phosphate (the 3rd circle) and the 5’ carbon, which means the circle will still be attached to the ring with the (X) attached to it, yet it is cleaved from the ring below it

Write the anticodon, with correct polarity of all tRNAs that will bind to the mRNA codon 5’ UCG 3’, considering wobble-base pairing rules.

3' AGC 5' 3' AGG 5' 3' AGU 5' 3' AGA 5'

Long term storage of genetic information in a cell occurs in...

DNA

What would be the sequence of an RNA produced by using the DNA sequence shown as a template sequence for above questiotemplate? DO NOT include 5’ and 3’ (write from 5’ to 3’) 3’ TACCGTGCGTGACATTAAGCC 5’

AUGGCACGCACUGUAAUUCGG

In DNA replication, the lagging strand is…

The strand which must be replicated in a direction away from the replication fork.

1)After the peptide bond forms, what will happen? tRNA A will be carrying the polypeptide and it will shift to the P site tRNA A will be carrying the polypeptide and it will shift to the A site tRNA B will be carrying the polypeptide and it will shift to the P site tRNA B will be carrying the polypeptide and it will shift to the A site 2) The next step in the translation of this mRNA will be the formation of a peptide bond between which two amino acids? amino acid 2 & amino acid 3 amino acid 2 & amino acid 4 amino acid 1 & amino acid 3 amino acid 1 & amino acid 2

1. tRNA B will be carrying the polypeptide and it will shift to the P site 2. amino acid 2 & amino acid 3

1. Process 2 is… | 2. Codons that specify the same amino acid are…

1. Translation: mRNA to protein | 2. Degenerate codons

DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide? Purine or pyrimidine nitrogen-containing bases A ribose sugar A deoxyribose sugar Phosphate DNA contains all of the above

Ribose sugar

In the late 1950s Meselson and Stahl grew bacteria in a medium containing “heavy” nitrogen (15N) and then transferred them to a medium containing 14N. Which of the tubes would be expected after one round of DNA replication in the presence of 14N?

Tube D The one with only one line in an intermediate position.

A short segment of an mRNA molecule is shown below. The polypeptide it codes for is also shown: 5'-AUGGUGCUGAAG : methionine-valine-leucine-lysine Assume that a mutation in the DNA occurs so that the 4th base (counting from the 5' end) of the messenger RNA now reads A rather than G. What sequence of amino acids will the mRNA now code for? ``` methionine-valine-methionine-lysine methionine-valine-leucine-lysine methionine-methionine-leucine-lysine methionine-lysine-leucine-lysine methionine-leucine-leucine-lysine ```

methionine-methionine-leucine-lysine

DNA polymerase I is thought to add nucleotides...

In place of the primer RNA after it is removed

What is the initiator triplet in both prokaryotes and eukaryotes? What amino acid is recruited by this triplet?

AUG, methionine

Which of the following clusters of terms accurately describes DNA as it is generally viewed to exist in prokaryotes and eukaryotes?

double-stranded, antiparallel, (A + T)/(C + G) = variable (A + G)/(C+ T) = 1.0

In eukaryotes, RNA polymerase __ transcribes the genes that encode proteins.

5’...GGAGCUCGUUGUAUU...3’ | Is this sequence RNA or DNA? How can you tell?

RNA, because DNA does not contain uracil.

What is a characteristic of DNA sequences at the telomeres? They consist of repeated sequences They consist of cytosine & adenine nucleotides One strand protrudes beyond the other, creating some single-stranded DNA at the end. All of the above

All of the above

Which of the following features distinguishes RNA from DNA? DNA has only purine bases RNA has a pentose sugar, while DNA utilizes a hexose sugar Unlike RNA, DNA uses a phosphodiester backbone RNA has only pyrimidine bases None of the above

None of the above

If the following DNA strand was used as a template, what would the sequence of an RNA be? 5’ GTACCGTC 3’

5′ GACGGUAC 3′

Which diagram shows a nucleotide with a purine base? Which diagram shows a nucleotide as it would appear in DNA? *Shows 5 different molecules*

Answer for both questions ^purines are Adenine and Guanine (the bases with two rings fused together) PO4, NH2

Which figure shows one of the amino acids that was key to distinguishing DNA from protein in the Hershey and Chase experiment?

``` COO- | H3N - C | CH2CH2 | S | CH3 ```

Which circle shows a phosphodiester bond? circle a circle b circle c circle d

Circle a

Which circle shows a bond that would also be found in an RNA transcribed from one strand of this DNA?

Circle a

Which circle shows a noncovalent bond?

Circle b

Three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes occur in which cellular organelle? ``` cytoplasm Golgi mitochondrion nucleus lysosome ```

nucleus Translation happens in the ribosome, Transcription is in the nucleus

The term peptidyltransferase relates to… discontinuous strand replication elongation factors binding to the large ribosomal subunit 5’ capping of mRNA peptide bond formation during protein synthesis base additions during mRNA synthesis.

peptide bond formation during protein synthesis

The poly A tail found in the 3’ end of an mRNA is important for all the processes listed below except for ______ and _______.

intron splicing and protein stability

An mRNA has the stop codon 5'UAA3'. What tRNA anticodon will bind to it? 5'ATT3' 5'AUC3" 5" ACU3' none

none

Uridine contains _______ as sugar.

ribose

Supercoiling caused by unwinding of the dsDNA molecule is relieved by what enzyme?

DNA gyrase

Which of the following traits exemplify plasmid DNA?

it often carries genes beneficial to its bacterial host and it replicates independently of the genomic DNA.

In what cellular compartment are introns removed from pre-mRNA to make mature mRNA?

nucleus

All of the following are general purpose translation components and could be used in the translation of any gene, except for which one? tRNA mRNA methionine initiation factors

mRNA

The long-term storage of genetic information in a cell occurs in the ____

DNA

The relationship between codon and anticodon can be characterized as involving _______ between complementary bases (usually) in typical _____ fashion.

hydrogen bonds, antiparellel

An organism has a T content of 24%. | What is the percentage for C?

If a DNA molecule of 50 base pairs contains 15 cytosine bases, how many thymine bases will it have?

Which of the following statements about a mammalian messenger RNA are FALSE?? ``` It is synthesized in the nucleus it is translated in the cytoplasm It usually contains a cap at the 5’ end It is usually much smaller than the initial transcript (that is copied directly from the gene) None of the above ```

None of the above

RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.

promoter

What would Avery, McCleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence?

That RNA was the genetic material

DNA polymerase III adds nucleotides

to the 3’ end of the RNA primer

In transcription, nucleotides are always added to the ___ end of the elongating strand.

3’

Gives sequence AAA TCT GGG GGG TCT AAA then translated, what is amino acid sequence?

N--- Phe-Arg-Pro-Pro-Arg-Phe---C

In eukaryotes, tRNAs are

transcribed in the nucleus, but function in the cytoplasm

What chemical group is found at the 5’ end of a DNA molecule?

phosphate group

What chemical group is found at the 3’ end of a DNA molecule?

hydroxyl group

DNA replication is semiconservative in that.. a) The two strands of the original double helix are conserved, but they become part of a separate progeny DNAs b) The two strands of the original helix are not conserved, but the base sequence is the DNA preserved. c) The base sequence of a DNA molecule is conserved, with very high fidelity, in DNA replication d) DNA replication can only follow the replication fork on the leading strand.

The two strands of the original double helix are conserved, but they become part of a separate progeny DNAs