Module 2 Practice Exam and Review Flashcards
What are the 3 classes of “functional” (non-mRNA) RNAs? Briefly describe the role of each class of functional RNA.
tRNA: brings the correct amino acid to the mRNA during translation
rRNA: major component of ribosomes
snRNA: helps process RNA transcripts (especially, helps remove introns).
- Messenger RNA: contains blueprint for protein synthesis
- Transfer RNA: brings correct amino acid to the ribosome
- Ribosomal RNA: makes ribosomes
Here is a list of eukaryotic RNA polymerases. Match them with what they transcribe.
RNA Pol I; RNA Pol II; RNA Pol III
mRNA, tRNA, rRNA, snRNA
?? RESEARCH THIS!!
RNA Pol I: rRNA
RNA Pol II: snRNA, mRNA
RNA Pol III: tRNA
continuous synthesis
leading strand
theta replication
bidirectional circular replication
In the Meselson-Stahl experiment, what hypothetical form of DNA replication results in the same DNA density distribution as the semiconservative method after the first cell division, but was not supported upon the second cell division?
??
dispersive replication?
Eukaryotes have two of these per chromatid; prokaryotes have none.
telomeres
In eukaryotes, tRNAs are
transcribed in the nucleus, but function in the cytoplasm.
As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?
The tRNA that was in the A site moves into the P site.
Transcription of the sequence AATGCGGTC would result in
UUACGCCAG
What is a gene?
A sequence of DNA that encodes a protein
Telomeres________________the end of chromosomes
stabilize
Which is true of the secondary structure of DNA?
Bases on complementary strands are held together by hydrogen bonds.
What is semiconservative replication?
??!!!!
Replication in which each of the original nucleotide strands remains intact, despite no longer being combined in the same molecule. The original DNA molecule is half conserved during replication. Each strand serves as a template for synthesis of a new strand. Production of two identical double strands of DNA consisting of one new strand and one original strand.
A friend gave you the following molecule and told you that it was a fragment of his RNA. Do you believe him? Justify your answer.
No, the molecule has T’s. If it were truly RNA, it would have U’s (Uracil) rather than T’s
An organism has a G content of 17%. What is the percentage for A?
33%
This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil.
RNA only
This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond between them.
DNA ligase
RNA polymerase II binds to the ____________ strand of DNA and uses it to guide transcription. In contrast, the strand not used to guide transcription is called the _____________ .
??!!!
leading, lagging?
Which of the following statements about the genetic code are TRUE?
Most amino acids are encoded by more than one codon
What chemical group is found at the 3’ end of a DNA molecule?
hydroxyl group
The nitrogenous base that is found in RNA but not in DNA is
uracil
What is the function of eukaryotic RNA polymerase I?
transcription of rRNA genes
Hairpins are formed in DNA as a result of
sequences on the same strand that are inverted and complementary
Translation of RNA into protein takes place on which cellular organelle?
Ribosome
What does “proofreading” refer to with regard to DNA replication?
??*
Looks for mismatched pairs
the ability for dna polymerase to remove and replace incorrectly paired nucleotides in the process of replication
Are Okazaki fragments formed on the leading strand during DNA replication? Explain your answer.
??*
No, they are what are linked together to form the lagging strand.
The bonds that connect nucleotides in a strand are called _________bonds.
phosphodiester
Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)?
Indicate the reason for your choice.
DNA molecule B has indeed a higher A-T content. However, G-C pairs are held together by 3 hydrogen bonds while A-T bonds are held together by 2 hydrogen bonds. Hence, the higher number for G-C pairs gives the double-stranded DNA A a higher heat resistance.
This method of replication preserves the covalent links on one strand of DNA but allows permanent separation of the “parental” double helix to form two templates.
semi-conservative replication
DNA ligase
phosphodiester bonds at DNA nicks
In what cellular compartment are introns removed from pre-mRNA to make mature mRNA?
Nucleus
Which of the following traits exemplify plasmid DNA?
It often carries genes beneficial to its bacterial host.
It replicates independently of the genomic DNA.
Which of the following statements is NOT true about enhancers?
Enhancers are recognized by and bind directly to RNA polymerase.
The role of tRNA is:
to act as transporters bringing amino acids to the site of protein synthesis.
Which diagram shows a nucleotide that would be used to make RNA?
??!!
Not the double ring one, with 3 total rings and one phosphate group
The DNA replication enzyme that most closely resembles RNA polymerase is
primase
A coworker in your lab discovered a strain of E. coli that has a nonfunctional RNA polymerase. He felt sorry for the suffering E. coli and decided to add an RNA polymerase enzyme and gene from Drosophila to this mutant E. coli to allow the mutant strain to survive. You think that this is a foolish idea that will not work. Put together an argument as to why the addition of a Drosophila RNA polymerase could not possibly allow this mutant E. coli to survive.
Prokaryotic and eukaryotic RNA polymerases are different. The Drosophila RNA polymerase will not be able to find the E. coli promoters and thus will not be able to transcribe any of the E. coli genes.
Prokaryotic and eukaryotic RNA polymerases are different. The Drosophila RNA polymerase will not be able to find the E. coli promoters and thus will not be able to transcribe any of the E. coli genes.
A number of scientists have become interested in telomerase as a drug target. Why would they be interested in telomerase? How might cancer drug therapies that target telomerase work?
??
Telomerase is an enzyme that prevents the telomeres of a chromosome from shortening. When the telomeres shorten, the cell eventually dies. In cancer cells, telomerase is constantly working so the cells never die.
90% of all cancers express telomerase. Cancer therapies may work to inactivate the overexpression of telomerase enzymatic activity in order to reduce the immortality conferred by telomerase which plays a role in cancer development.
The enzyme telomerase allows for replacement of short bits of DNA known as telomeres, which are otherwise shortened when a cell divides via mitosis.
In normal circumstances, without the presence of telomerase, if a cell divides recursively, at some point all the progeny will reach their Hayflick limit. With the presence of telomerase, each dividing cell can replace the lost bit of DNA, and any single cell can then divide unbounded. While this unbounded growth property has excited many researchers, caution is warranted in exploiting this property, as exactly this same unbounded growth is a crucial step in enabling cancerous growth.
The poly(A) tails found in the 3’ end of an mRNA are important for all the processes listed below except for ___ and ___.
intron splicing
protein stability
This new strand of DNA has its 3’ end oriented in the opposite direction as that in which the replication fork travels.
lagging strand
DNA gyrase
supercoil removal
This organic subunit is the monomer from which nucleic acid is formed.
??!!
Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine?
12
What is the function of peptidyl transferase activity?
It forms peptide bonds.
What is the function of the TATA binding protein?
Allows eukaryotic RNA polymerase II to bind to the promoter of genes
Heterochromatin is characterized by all of the following, EXCEPT that it
contains genes that require high levels of transcription.
Heterochromatin is characterized by all of the following:
is present at centromeres and telomeres.
is present on most of the Y chromosome.
remains highly condensed throughout the cell cycle.
is present all over the inactive X chromosomes in mammals.
The chemical differences between DNA and RNA make RNA __________ stable than DNA and allow it to exist __________ in the life of most cells.
The chemical differences between DNA and RNA make RNA less stable than DNA and allow it to exist temporarily in the life of most cells.
The poly(A) tails found in the 3’ end of an mRNA are important for ___ and ___.
mRNA stability
translation
How many primase molecules are needed on the leading strand? The lagging strand?
Leading = 1 Lagging = Multiple one for each Okazaki fragment.
Telomeres regulate the replication of the ends of chromosomes in eukaryotes. Why is this structure implicated in human aging?
Telomeres are structures at the ends of eukaryotic chromosomes that contain tandem DNA sequences added to the 3′ ends by the enzyme telomerase. Telomeres stabilize chromosomes by preventing the loss of genomic information after each round of DNA replication. Human somatic cells contain little or no telomerase, and those that do get progressively shorter and enter premature senescence. People with diseases of premature aging such as Werner syndrome and dyskeratosis congenital have shorter telomeres than healthy people.
Telomeres are structures at the ends of eukaryotic chromosomes that contain tandem DNA sequences added to the 3′ ends by the enzyme telomerase. Telomeres stabilize chromosomes by preventing the loss of genomic information after each round of DNA replication. Human somatic cells contain little or no telomerase, and those that do get progressively shorter and enter premature senescence. People with diseases of premature aging such as Werner syndrome and dyskeratosis congenital have shorter telomeres than healthy people.
If the bottom strand of the DNA (sequence not shown, but complementary to the sequence 5’ AGGGTCCAC 3’) is the template, the RNA sequence, left to right 5’ to 3’, is:
AGGGUCCAC
Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5’ UCG 3’, considering wobble-base pairing rules.
3’ AGC 5’
3’ AGG 5’
3’ AGU 5’
3’ AGA 5
Short “bursts” of DNA synthesis on the lagging strand produce ___________.
okazaki fragments
DNA primase
RNA primer synthesis
DNA replication is semi-conservative in that
The two stands of the original helix are conserved, but they become part of separate progeny DNAs.
Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon?
differences in pre-mRNA splicing that results in an altered pattern of exon inclusion.
Which of these sequences could form a hairpin?
5’ GGGGTTTTCCCC 3’
The following statements about a mammalian messenger RNA are true:
It is synthesized in the nucleus.
It is translated in the cytoplasm.
It usually contains a cap at the 5’ end.
It is usually much smaller than the initial transcript (that is copied directly from the gene).
Reverse transcriptase (from a retrovirus like HIV) generates
DNA from RNA
Kornberg used the phage PhiX14 to demonstrate DNA pol I was able to produce biologically active DNA in vitro. Briefly describe the experimental methods that he used to draw the conclusions that DNA pol I could produce biologically active DNA.
??
- Initial (+) strand of PhiX174 was labeled with 3H, added to DNA pol 1, ligase, bromouracil and 32P labeled dNTP to produce (-) strand
- dsRF was nicked, made single stranded, and new (-) strand was isolated following centrifugation.
- (-) strand was used with DNA pol 1, ligase, unlabeled dNTPs to produce a new (+) strand in vitro.
- new (+) strand was successfully used to infect E coli and produce new PhiX174 phage particles
- demonstrated that DNA pol 1 was capable of producing biologically active DNA in vitro
Explain at least two reasons why the following definition of a gene is inadequate: “A gene consists of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide.”
??
1) alternative splicing–multiple RNA molecules from single DNA sequence
2) polycistronic RNA–multiple proteins from single RNA transcript
Codon that specify the same amino acid are said to be _________________.
?!!? degenerate
An organism has an A + T content of 64%. What is the percentage for C?
18
What would be the sequence of an RNA produced by using the DNA sequence shown as a template?
3’ TACCGTGCGTGACATTAAGCC 5’
5’ AUGGCACGCACUGUAAUUCGG 3’
If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)?
30%
Which of the following statements best describes the messenger RNA?
mRNA is the only type of RNA that carries DNA’s protein building instructions
A bacterial protein is encoded by the following mRNA sequence: AUGGUGCUCAUGCCCTAA.… The second methionine codon (AUG) in this mRNA sequence will
encode unformylated methionine.
Which enzyme catalyzes the elongation of a DNA strand in the 5’ → 3’ direction?
DNA polymerase III
The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation?
It bends and partly unwinds DNA at a promoter.
Which three general characteristics must the genetic material possess?
??
Variance by mutation
Expression
Replication
How did the work of Hershey and Chase contribute to the model of DNA as the genetic material?
??
Hershey and Chase designed a series of experiments to determine whether phage protein or DNA is transmitted in phage replication. They used radioactive forms of phosphorus and sulfur to follow DNA and protein. When new phage progeny emerged, many emitted radioactivity from 32P, demonstrating that DNA had been passed on during reproduction.
RNA differs from DNA in that it:
has uracil rather than thymine.
is usually single-stranded rather than double-stranded.
has ribose sugars rather than deoxyribose sugars in its nucleotides.
rolling-circle replication
unidirectional replication
The 3’ untranslated region affects the ___ of mRNA and the ___ of the mRNA protein-coding sequence.
??!!
Type the complementary strand to the following single-stranded DNA.
5’ – ATAGCATGGGCCATACGATTACTGA – 3’
5’ TCAGTAATCGTATGGCCCATGCTAT 3’
In the late 1950s, Meselson and Stahl grew bacteria in a medium containing “heavy” nitrogen (15N) and then transferred them to a medium containing 14N. Which of the results in the above figure would be expected after one round of DNA replication in the presence of 14N?
….
In DNA replication, the lagging strand is
the strand which must be replicated in a direction away from the replication fork.
If the following DNA sequence
5’———TTT AGA CCC CCC AGA TTT—–3’
3’———AAA TCT GGG GGG TCT AAA—–5’
is transcribed and translated, what would be the primary sequence of the final protein product?
Note: UUU, AGA, and CCC code for phenylalanine (Phe), arginine (Arg) and proline (Pro), respectively. N and C in the following answers refer to the N and C termini, respectively
N—–Phe-Arg-Pro-Pro-Arg-Phe—- C
Which is not true of amino acids?
a) There are 20 of them required in the body
b) They are the building blocks of proteins
c) tRNA brings them to the ribosome for protein synthesis
d) all of the above are true
There are 20 of them required in the body
They are the building blocks of proteins
tRNA brings them to the ribosome for protein synthesis
Which of the following best describes the addition of nucleotides to a growing DNA chain?
A nucleoside triphosphate is added to the 3’ end of the DNA, releasing a molecule of pyrophosphate.
Genetic material must replicate faithfully. Describe how the double-stranded structure of DNA gives it this property.
??
The double-stranded structure can be used as a template. Each strand is replicated so that the information is passed down correctly.
What happens to a chromosome that loses its centromere?
???
A+G=T+C
yes___
This short piece of RNA is present only transiently in a newly-synthesized DNA molecule.
RNA primer
This new strand of DNA has its 3’ end oriented in the Same direction as the replication fork travels.
leading strand
In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts?
DNA contains phosphorus, but protein does not
Which statement is true regarding negative supercoiled DNA?
That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription.
To translate a mRNA you require two other RNAs. These are
tRNA and rRNA.
In biology, most information flows through which sequence?
DNA to RNA to protein
In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5’ to 3’ direction.
In each round of the elongation cycle of protein synthesis, a new aminoacyl-tRNA binds to the codon in the A site, then the peptide is transferred from the tRNA in the P site to the new aminoacyl-tRNA, and finally the entire ribosome moves along the mRNA in a 5’ to 3’ direction.
Which of the sequences could form a hairpin?
CGCCAAAAAATCGCCCCCCAATTA
TTCAATAATCGCTAATAACTGA
TTACGGCGGTTCCGCCGGTG
GCCGCCGCCGCCCCATTATTATTAT
ATTATTTCGTACCCCCAATTTT
ATTAGGCCCTACCGCCAATTTT
TTACGGCGGTTCCGCCGGTG
You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps. You obtain a sample of this bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how the Mars bacteria replicates its DNA. Based on the following equilibrium centrifugation results, what type of replication would you propose for this new bacteria?
??
Which different DNA polymerases are found in eukaryotic cells? What are their functions?
??
Alpha- initiates nuclear DNA synthesis and repair, primase activity
Beta- DNA repair and recombination of nuclear DNA
Gamma- replication and repair of mitochondrial DNA
Delta-continues replication, leading and lagging strand synthesis, DNA repair, translesion DNA synthesis
Epsilon- leading strand synthesis
Polymerase Beta and Epsilon are involved in DNA repair, A, B, and E are essential to DNA replication. Polymerase gamma is involved in the synthesis of mitochondrial DNA.
Splicing of eukaryotic pre-mRNA involves ___ reactions and occurs in the ___ .
Splicing of eukaryotic pre-mRNA involves transesterification reactions and occurs in the nucleus.
Heinz Shuster collected the following data on the base composition of ribgrass virus (H. Schuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. NY: Academic Press, 1955).
On the basis of this information (see below) is the hereditary information of the ribgrass virus RNA or DNA? Is it likely to be single stranded or double stranded?
Percent: A: 29.3 G: 25.8 C: 18.0 T: 0.0 U: 27.0
single stranded RNA
Uridine contains ____ as sugar.
ribose
The concept that genetic information passes from DNA to RNA to protein is called
Central Dogma
The packaging of DNA into a confined space is what level of DNA structure?
tertiary
Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following, EXCEPT that
genetic material must be composed of many different units to account for the variability seen in nature.
(this was not known before DNA was identified as the genetic material)
Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following:
genetic material must encode the phenotype.
genetic material must replicate faithfully.
genetic material must contain complex coding information
What would Avery, Macleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence?
that RNA was the genetic material
What would Hershey and Chase have concluded if phage ghosts contained 32P label but were absent from infected E. coli? Furthermore, they found 35S lacking in the ghosts and present in the infected E. coli.
that protein was the genetic material in phage
