finals (I'M BACK ON BRAINSCAPE) Flashcards
for bio 1 final
What is the purpose of the respiratory system? How is the purpose of the circulatory system related to this?
circulatory system
* function and purpose: transports oxygen, carbon dioxide, waste, and nutrients around the body
respiratory system
* function and purpose: to take in oxygen and exchange it for carbon dioxide
how they’re related
the oxygen that the respiratory system takes in is delivered to the bloodstream and “handed off” to the circulatory system
What are the major differences between arteries and veins?
arteries
* carry blood Away from the heart
* have a thicker muscular wall
* carry blood with a higher pressure
* help to regulate blood pressure
* carry O2 rich blood
veins
* carry blood towards the heart
* have a larger opening (lumen) and valves to prevent backflow of blood
* carry blood with little pressure
* don’t help regulate blood pressure
* carry O2 poor blood
What is the role of capillaries? How does their structure allow them to carry out this function?
- capillaries are very thin blood vessels where nutrients and oxygen diffuse into your body tissue and cells
- they connect small arteries to small veins
- they are thin (walls are one cell thick) so this allows for diffusion of many different substances, such as nutrients, fluids, and gases between cells and bloodstream
red blood cell
transports oxygen and carbon dioxide to and from body cells (contains the protein hemoglobin which binds to oxygen)
white blood cells
defends against pathogens and cancer cells
platelets
function in blood clotting
plasma
the liquid part of blood
Describe the four main chambers of the heart
right atrium
* receiving chamber
* in upper left corner of diagram
* receives o2 poor blood
left atrium
* receiving chamber
* in upper right corner of diagram
* receives o2 rich blood
right ventricle
* pumping chamber
* in lower left corner of diagram
* pumps o2 poor blood to lungs
left ventricle
* pumping chamber
* in lower right corner of diagram
* pumps o2 rich blood to the rest of the body
What is the role of the AV valves (tricuspid and mitral) and semilunar valves (aortic and pulmonary)? Where are they in the heart?
semilunar valves
* where blood is pumped out of the heart into major arteries
* pulmonary valve (left on diagram) goes into the pulmonary artery out the upper right
* aortic valve (right on diagram) goes into the aorta on top
* like in the middle of the heart?
AV valves
* between atria and ventricles
* tricuspid valve (left on diagram)
* mitral/bicuspid valve (right on diagram)
generally they prevent the backflow of blood in the heart
Describe a diagram of the heart. Where is everything in relation to each other?
- aorta is at the top
- superior vena cava is to the left of the aorta
- the inferior vena cava is directly below the superior vena cava but at the lower left corner
- right atrium is right below superior vena cava
- tricuspid valve is in between right atrium and right ventricle
- right ventricle is at the lower left corner but not super close to the inferior vena cava
- pulmonary valve is in between right ventricle and pulmonary artery
- pulmonary artery makes like a right angle and goes out to the upper right corner
- left ventricle is at the lower right corner, goes into the aorta
- aortic valve is in between left ventricle and aorta
- mitral/bicuspid valve is in between left atrium and left ventricle
- left atrium is kind of “inside” the pulmonary vein, which is at the slightly upper right corner
What are the purposes of the things listed in the answer in the circulatory system?
Feel free to ask guiding questions with this.
superior vena cava
* receives o2 poor blood from upper body
* brings it to the right atrium, then it goes through the tricuspid valve to the right ventricle, then through the pulmonary valve to the pulmonary artery, which brings the o2 poor blood to the lungs
pulmonary vein
* receives o2 rich blood from lungs
* brings it to the left atrium, then through the mitral vave to the left ventricle, then through the aortic valve to the aorta
inferior vena cava
* receives o2 poor blood from lower body
right atrium
right ventricle
left atrium
left ventricle
Describe one possible pathway of a red blood cell through the body starting from the right atrium and ending back at the right atrium. Be sure to mention the blood vessels that the blood is traveling through AND the oxygen/carbon dioxide content of the blood at each point.
- it is in o2 poor co2 rich blood at this point in the right atrium
- as the right atrium is filled with blood, it contracts and the tricuspid valve opens, which pumps blood into the right ventricle
- when the right ventricle is full, the tricuspid valve closes to prevent blood from flowing back into the right atrium
- the right ventricle contracts, opening the pulmonary valve, which then pumps blood to the pulmonary artery and to lungs
- pulmonary valve closes to prevent blood from flowing back into the right ventricle
What is atherosclerosis and how does high blood pressure affect this process?
- disease of the arterial wall caused by the formation of plaques
- cholesterol is deposited in damaged artery wall (this becomes plaque)
- when plaques rupture, a blood clot can form leading to blockage of small arteries (can cause heart attacks or strokes) and stops the delivery of blood to important organs
- atherosclerosis causes arteries to thin, lose strength, and lose flexibility
Where are blood cells made?
in bone marrow
What is blood pressure?
- the force exerted on a vessel wall by the bloodstream
- usually refers to pressure in arteries closest to the heart
- pressure is higher during systole (when the left ventricle pumps blood) and lower during diastole (when the left ventricle receives blood)
What affect does hypertension have on the heart?
- heart must work harder to pump against a greater resistance (can cause the heart to weaken over time)
- hypertension damages the artery walls and can damage capillaries in many organs (brain, heart, kidneys, eyes, etc.)
Put the following structures in the correct order in which oxygen molecules pass through on their way into the blood: larynx, trachea, alveoli, pharynx, bronchi, nasal cavity, bronchioles
- nasal cavity
- pharynx
- larynx
- trachea
- bronchi
- bronchioles
- alveoli
What important event occurs in the alveoli of the lungs? Why must capillaries surround the alveoli in order for this to happen?
- alveoli are air sacs at the end of our airways
- oxygen diffuses from the alveoli into the blood
- carbon dioxide diffuses out of the blood into the alveoli so it can be exchanged
- capillaries allow for this diffusion to occur
Describe the relationship between atmospheric pressure, intrapulmonary pressure (the pressure inside the lungs) and the movements of the diaphragm and rib cage during both inspiration (breathing in) and exhalation (breathing out).
*diaphragm moves down during inhalation and up during exhalation
*during inhalation, intrapulmonary pressure is lower than atmospheric pressure and vice versa during exhalation
*during inhalation, intercostal muscles contract and expand ribcage
*during exhalation, intercostal muscles relax and ribcage collapses
What is the purpose of stretching and recoiling of arteries as blood moves through them?
it can help blood move away from the heart
How does hypertension affect the following: elastic arteries, muscular arteries, heart attacks, and heart failure?
elastic arteries
hypertension allows elastic fibers in the tunica media to expand and contract
muscular arteries
hypertension causes friction to occur on the wall of the arteries
heart attacks
hypertension causes damage to the tunica intima, cholesterol then forms plaque on the walls of the artery
heart failure
heart failure weakens the heart muscle so it is unable to pump enough blood
What can happen if a plaque ruptures and why is it dangerous?
- if a plaque ruptures, plaque can clot at the sight of the plaque rupture (thrombosis)
- the bigger the blood clot gets, the less blood it lets flow
- if the artery is fully blocked, artery supplied tissues can die
What happens leading up to and during a heart attack?
- plaque builds up in coronary arterial walls
- if it ruptures, blood clots inside the artery (thrombosis) can occur
- this causes less blood to reach the heart
- if the clot fully blocks the coronary arterial walls, all muscle tissue below the clot can die, causing a heart attack
What is an ischemic stroke and why is it dangerous?
- in the internal carotid artery, plaque from atherosclerosis causes less blood flow
- if the plaque ruptures, small pieces of plaque and clotted blood can go to the brain
- it’s dangerous bc if an embolus, a foreign piece of mass, is in the artery, it stops blood flow to part of the brain
What is a hemorrhagic stroke and why is it dangerous?
- if arteries penetrate brain tissue, they can rupture and cause bleeding
- cerebral artery aneurysms can be the cause of subarachnoid bleeding
- small arteries bleed and rupture into brain tissue
Compare and contrast TIAs and ischemic strokes.
- literally the only difference is that with TIAs, if the blockage dissolves, blood flow resumes
What is an angiogram? How and why is it performed?
- radiopaque dye is injected to determine if there is narrowing or a blockage in the right coronary artery
- the balloon catheter is inserted over the guide wire and it’s put in the correct position
- the balloon is inflated, which then crushes the plaque to resume the bloodstream
What is a stent? How and why is it used?
- after an angioplasty the balloon is reinflated to use the stent
- drug eluting stents have a polymer coating them that releases drugs which prevents the artery from narrowing again
How does coronary bypass surgery help to prevent heart attacks?
- it creates new passages for the blood to flow to your heart muscle
- it takes blood vessels from other parts of your body, called grafts, and it uses those blood vessels to reroute clogged arteries
What is the location and purpose of cilia in the respiratory system?
they trap foreign particles from the air and push them to the throat so they don’t enter the lungs
Which structure prevents food from entering the airways?
epiglottis
In which structure are the vocal folds (a.k.a vocal cords) located? How does testosterone affect the thickness of vocal cords and how does this affect how deep a person’s voice is (Google this one to find out)?
- they’re in the larynx
- testosterone thickens them, which lowers a person’s voice
What is the diaphragm?
a flat muscle below the lungs
What is bronchitis?
- airways get infected, causing mucus creation and coughing
- inflammation also occurs
What is emphysema?
- alveoli break down, resulting in less surface area than is needed for gas exchange with capillaries on the alveoli
What is the structure of nucleotides?
Nucleotides are linked together by bonds between phosphate groups and deoxyribose sugars (sides of molecule)
phosphates are the ladder backbones of the DNA
DNA strands are antiparallel to each other. What does that mean?
- each strand has a 5’ end and a 3’ end
- the two strands run in opposite directions
- The 5 and 3 refer to the carbon atoms on the deoxyribose sugar
Describe the process of DNA replication.
- two strands are separated by an enzyme called helicase, resulting in the formation of a replication fork
- each strand provides a template for creating a new strand of DNA
- an enzyme called primase starts the process, making a small piece of RNA called a primer
- an enzyme called DNA polymerase binds to the primer and makes a new strand of DNA
- it can only add bases in one direction: from the 5’ end to the 3’ end
- one of the new strands, a leading strand, is made continuously, from 5’ to 3’
- the lagging strand can’t be made continuously because it’s made in the opposite direction, from 3’ to 5’
- DNA polymerase can only make the lagging strand in a series of small chunks known as Okazaki fragments
- each fragment is started by an RNA primer
- DNA polymerase then adds a short row of RNA bases in the 5’ to 3’ direction
- the next primer is added further down the lagging strand
- another Okazaki fragment is made and the process repeats
- once the DNA is made, the enzyme exonuclease removes all RNA primers from the new strands of DNA
- DNA polymerase fills in the gaps left behind w/DNA
- enzyme DNA ligase seals up DNA fragments in both strands to form a continuous double strand
What are the base pairing rules of DNA?
- A and T have 2 hydrogen bonds
- G and C have 3 hydrogen bonds
What happened during the Hershey Chase experiment?
first phase
1. phage was produced in a medium that also contained S-35 amino acids
2. this led to a phage population with S-35 labeled proteins, but no label in DNA
3. phage infected the bacteria by attaching to the outside of the cell and injected the DNA into the cell, but the protein coat stayed on the outside of the cell
4. phage in these cells were not radioactive
5. when intense shaking occurred, protein coat shook off, but phage production in the cell was unaffected
second phase
6. phage were produced in a medium that had P-32 nucleotides
7. this led to a population with P-32 labeled nucleotides, but no label in the protein
8. when the phage infected the bacteria, radioactive DNA entered the cell and was found in phage that was later produced in the bacteria
Why would radiation help combat cancer?
- it damages cancer cells
- interferes with uncontrolled cell division
What phase of the cell cycle is most affected by radiation?
G1
mitosis is also affected a bit though
it can also cause DNA errors during synthesis and if apoptosis doesn’t occur DNA damage can spread, causing tumors
How does semi-conservative replication help prevent mutations during DNA replication?
half of the original molecule is already there to serve as a template for the new strand
Define cancer. What are some characteristics of cancer cells?
- often have at least 60 mutations
- they take nutrients from healthy cells
- they can’t perform the tasks that healthy cells need to do
- they crowd out healthy cells
- does not have much apoptosis (cell suicide)
- uncontrolled growth of abnormal cells
- shortens the cell cycle and affects gap1 and mitosis the most
- since the cell cycle is shortened, doctors have to act quickly
angiogenesis
when cancer cells release chemicals that cause bloood vessels to grow towards the tumor to supply it with nutrients and allow it to metastasize (spread
benign vs. malignant
benign
* confined to one area; slow growing
* stage 0 tumors are benign
malignant
* can spread to other areas; fast growing
* stages I, II, III, and IV tumors are malignant
cleavage furrow
indentation in the cell membrane of an animal cell during cytokinesis
cell plate
new cell wall formed during a plant cell’s cytokinesis
Describe each stage of mitosis.
prophase
* nuclear membrane breaks down
* spindle fibers made of microtubules begin to lengthen as centrioles move apart
* chromatin coils into visible chromosomes
metaphase
* spindle fibers are attached to the centromeres of the chromatids
* chromosomes are pulled to the equator (or middle) of the cell)
* nucleus is gone btw
anaphase
* sister chromatids of duplicated chromosomes are pulled apart as spindle fibers shorten and move to opposite ends of the cell
telophase
* new nucleus forms around each set of chromosomes
* cell membrane pinches inward at center
* chromosomes unwind into chromatin
* spindle fibers break down
cytokinesis
* division of the cytoplasm
Describe each stage of the cell cycle.
gap1 (11 hrs)
* cell grows bigger and functions normally
* has checkpoints (is the cell big enough? are there enough energy and other reserves? is the DNA damaged?)
gap0
* cell stops dividing
* happens to damaged cells to ensure the damage doesn’t spread
* goes into this phase during G1
synthesis (8 hrs)
* cell copies DNA
gap2 (4 hrs)
* cell makes more organelles and proteins for division
* has checkpoints (did all our DNA get replicated together? is the DNA damaged?)
mitosis (1 hr)
* cell divides duplicated chromosomes/DNA evenly
* cell divides cytoplasm and organelles (cytokinesis)
What are stem cells?
- Cells that give rise to all of the cells in the body
- Stem cells can divide to create many different types of cells in the body (or to make new stem cells)
- When stem cells become a particular specialized type of cell (like a white blood cell, for example), they are said to have differentiated
Why is cell division important?
- The cell’s interior grows at a faster rate than the plasma membrane
- At a certain point, membrane transport cannot supply the needs of the cell (nutrient uptake, excretion of waste, etc.)
- Cells must stay small to remain efficient
Describe the role of proto-oncogenes and tumor suppressor genes in the cell cycle. Also explain how these genes can be involved in the development of cancer
proto-oncogenes
* start cell division
tumor suppressor genes
* stop cell division
* p53 is a tumor suppressor gene (mutated in more than half of all cancers)
* it activates DNA repair (stops cell cycle from G1 going into S phase)
* It initiates apoptosis (cell self-destruction) if DNA damage is too much to fix
When both types of genes are mutated in the same cell, the cell can divide out of control
In a plasmodial slime mold, which is one huge cytoplasmic mess with many nuclei, what stage of the cell cycle is skipped?
- during mitosis the cell splits, but in this single cell, there are many nuclei, indicating that mitosis was skipped
How is chemotherapy a good cancer treatment? How can some side effects, such as hair loss and nausea be targeted by this?
- it stops cell division and therefore contains cancerous cells
- cells that divide rapidly are targeted by chemo, so that explains the side effects
Describe transcription.
- Transcription factors assemble at a specific promoter region along the DNA.
- The length of DNA following the promoter is a gene and it contains the recipe for a protein.
- A mediator protein complex arrives carrying the enzyme RNA polymerase.
- It manoeuvres the RNA polymerase into place… inserting it with the help of other factors between the strands of the DNA double helix.
- The assembled collection of all these factors is referred to as the transcription initiation complex… and now it is ready to be activated.
- The initiation complex requires contact with activator proteins, which bind to specific sequences of DNA known as enhancer regions (These regions may be thousands of base pairs distant from the start of the gene.)
- Contact between the activator proteins and the initiation-complex releases the copying mechanisM.
- The RNA polymerase unzips a small portion of the DNA helix exposing the bases on each strand.
- Only one of the strands is copied.
- It acts as a template for the synthesis of an RNA molecule which is assembled one sub-unit at a time by matching the DNA letter code on the template strand.
- The sub-units can be seen here entering the enzyme through its intake hole and they are joined together to form the long messenger RNA chain snaking out of the top.
Describe mRNA editing and splicing.
- As DNA is transcribed into RNA it needs to be edited to remove non-coding regions, or introns, shown in green.
- This editing process is called splicing, which involves removing the introns, leaving only the yellow, protein-coding regions, called exons..
- RNA splicing begins with assembly of helper proteins at the intron/exon borders.
- These splicing factors act as beacons to guide small nuclear ribo proteins to form a splicing machine, called the spliceosome.
- The spliceosome then brings the exons on either side of the intron very close together, ready to be cut.
- One end of the intron is cut and folded back on itself to join and form a loop
- The spliceosome then cuts the RNA to release the loop and join the two exons together.
- The edited RNA and intron are released and the spliceosome disassembles.
How do introns allow for many different proteins to be produced from a singular gene?
Exons from the same gene can be spliced together in different combinations to make different proteins
Describe translation.
- the ribosome is composed of one large and one small sub-unit that assemble around the mRNA, which then passes through the ribosome like a computer tape.
- The amino acid building blocks are carried into the ribosome attached to specific tRNAs.
- The small sub-unit of the ribosome positions the mRNA so that it can be read in groups of three letters known as a codon.
- Each codon on the mRNA matches a corresponding anti-codon on the base of a tRNA molecule.
- The larger sub-unit of the ribosome removes each amino acid and join it onto the growing protein chain.
- As the mRNA is ratcheted through the ribosome, the mRNA sequence is translated into an amino acid sequence.
- There are three locations inside the ribosome, designated the A-site, the P-site and the E-site.
- The addition of each amino acid is a three step cycle: First, the tRNA enters the ribosome at the A-site and is tested for a codon/anti-codon match with the mRNA.
- Next, provided there is a correct match, the tRNA is shifted to the P-site and the amino acid it carries is added to the end of the amino acid chain.
- The mRNA is also ratcheted on three nucleotides or one codon.
- Thirdly, the spent tRNA is moved to the E-site and then ejected from the ribosome to be recycled.
- As the protein synthesis proceeds, the finished chain emerges from the ribosome.
- It folds up into a precise shape, determined by the exact order of amino acids.
review
Transcribe and translate the following strand: TACGCACATTTACGTACGCGG. What is a mutation came and changed the fourth G to a T?
- AUGCGUGUAAAUGCAUGCGCC
- Met Arg Val Asn Ala Cys Ala
- it would be TCA, transcribed to AGU instead. Met Ser Val Asn Ala Cys Ala. A different protein would be formed. The mRNA code is changed and therefore changes the tRNA code and that changes the protein and therefore changes the function it carries out.
