Exam HT20

Question 1

Does mammalian cells fit the following descirption?

PTM: Nearly none
Speed (from plasmid –> expression): weeks
General costs including investments: low

Answer 1

No! The answer is suiting for e.coli.

Question 2

Does e.coli fit the following description?

PTM: Nearly none
Speed (from plasmid –> expression): weeks
General costs including investments: low

Answer 2

Yes.

No post-translational modifications. Quick expression from plasmids, and cheap.

Question 3

Does the following description fit BEVS?

Speed (from plasmid to expression): Months
General costs including investments: medium
PTM: some

Answer 3

Yes!

It’s a jack of all trades.

Question 4

Does the following descrption fit BEVS?

Speed (from plasmid to expression): Weeks or months.
General costs including investments: high
PTM: Nearly all

Answer 4

No. This is more fitting of mammalian cells than BEVS. BEVS TPM are somewhat occurring and the speed of expression is slow.

Question 5

What’s a VLP?

Answer 5

VLP = Virus-like particles.

VLPs are non-infectious because they don’t carry any viral genetic material. VLPs can be used as carriers for other genetic material.

Question 6

What’s a continuous cell line?

Answer 6

A continuous cell line has been immortalized and can thus grow forever. The immortalization can occur via hybridisation with a cancer cell line.

Question 7

Which of the following methods utilizes the 3’ –> 5’ activity of T4 polymerase?

Ligation independent cloning
Bac-to-Bac
FlashBac
Topo-TA
The gateway system

Answer 7

LIC.

The T4 exonuclease activity generates large 3’ overhangs which are he main driving force behind the ligation.

Question 8

Why do we add tags to recombinant proteins? Two answers are correct.

A. To allow affinity purification of the expressed protein
B. To increase the isoelectric point of the expressed protein
C. To increase the mass of the expressed protein
D. To improve solubility of the expressed protein
E. To decrease the pH of the expressed protein
F. To improve formation of inclusion bodies by the expressed protein
G. To allow the proteins to be analyzed by SDS-PAGE

Answer 8

A: To allow affinity purification of the expressed proteins (just like we did in the lab, using IMAC)

D. To improve the solubility of the expressed protein.

Question 9

What’s the elongated wording of “CHO cell line”. What are the benefits to the cell line?

Answer 9

Chinese ovary hamster cell line.

Benefits:
- Post-translational modifications occur in a huge extent.

Question 10

What’s methotrexate? Explain how DHFR and recombinant proteins are assocaited to it.

Answer 10

Methotrexate is a cytostatic drug which is similar to folic acid. In the CHO cell line, DHFR catalyses the formation of purines from folic acid.

In order for DHFR/methotrexate selection to work, you need to things:
1. DHFR defficicent CHO cell line.
2. Plasmid with gene of interest + DHFR

When introducing recombinant DNA to the CHO cell line, you conjugate the gene for DHFR to it. Then you cultivate the cell line in methotrexate. The dosage of methotrexate will increase over time, only the cells with proper incorporation of the recombinant plasmid will survive due to its surplus of DHFR. The cells which are not transfected do not have any DHFR, especially not a surplus which is required for mtx not to inhibit its function any way. This leads to them dying.

Question 11

Excess primers and unincorporated nucleotides can be enzymatically removed from an amplified PCR product. What enzymes are needed?
a. DNA polymerase combined with DNA kinase
b. Exonuclease I combined with alkaline phosphatase
c. Ribonuclease H combined with alkaline phosphatase
d. DNA ligase combined with topoisomeras I
e. Exonuclease I combined with DNA ligase

Answer 11

b. Exonuclease I combined with alkaline phosphatase

Reasoning:
The exonuclease 1 will cleave all remaining primers into individual nucleotides. The alkaline phosphatase dephsosphorylises the 5’ phosphate of the nucleotides, making them effectively useless.

Question 12

How does a bacterial cell protect its own DNA from restriction enzymes?
a. adding methyl groups to adenines and cytosines
b. using DNA ligase to seal the bacterial DNA into a closed circle
c. adding histones to protect the double-stranded DNA
d. forming “sticky ends” of bacterial DNA to prevent the enzyme from attaching
e. reinforcing the bacterial DNA structure with covalent phosphodiester bonds

Answer 12

a. adding methyl groups to adenines and cytosines

Question 13

The Gibson assembly reaction mixture does not include:
a. all four deoxynucleoside triphosphates.
b. dsDNA fragments with overlapping ends.
c. DNA ligase.
d. 5’ Exonuclease.
e. Oligonucleotide primers.

Answer 13

e. Oligonucleotide primers.

You don’t need primers, nucleotides are needed because the plasmid needs to be repaired in the organism which it’s being transformed to.

Im a little usnure.

Question 14

FRET is useful for nanoscale proximity detection in microscopy. This due to its inherent
a. linear distance dependence
b. inverse linear distance dependence
c. inverse-sixth-power distance dependence
d. non-radiative energy transfer
e. good dynamic range

Answer 14

c. inverse-sixth-power distance dependence

It is what it is.

Question 15

You would like to generate a DNA fragment with a single stranded overhang as shown below. Which of the following reagents do you need in your reaction mixture.
5´TACTTCCAATCCATG 3´
3´————–C 5´
a. E. coli DNA polymerase + dNTP
b. T4 DNA polymerase + dNTP
c. E. coli DNA polymerase +dGTP, dTTP, dATP
d. T4 DNA polymerase + dGTP, dTTP, dATP
e. T4 DNA polymerase + dCTP

Answer 15

e. T4 DNA polymerase + dCTP

T4 DNA polymerase has 3’ –> 5’ exonucleic activity. The activity is only available when there are no nucleiotides to be incorporated. Whenvever the exonuclease finds a base which it can build upon, the polymerase activity will start up.

Question 16

A small molecule that is not antigenic by itself, but is eliciting an immune response when attached to a large carrier molecule is called a
a. Nanobody
b. Hapten
c. Idiotope
d. Adjuvant
e. Epitope

Answer 16

b. Hapten

Question 17

During agarose gel electrophoresis most of the power is dissipated as heat. Heating of the electrophoretic medium has the several effects. Which alternative is not correct?
a. An increased rate of diffusion of sample and buffer ions, leading to broadening of the separated samples.
b. The formation of convection currents, which leads to mixing of separated samples.
c. A decrease of buffer viscosity, and hence a reduction in the resistance of the medium.
d. An increase of buffer viscosity, and hence a reduction in the resistance of the medium.
e. Using a constant power eliminates fluctuations in heating

Answer 17

d. An increase of buffer viscosity, and hence a reduction in the resistance of the medium.

When you heat up a viscuous liquid, it’s very rare that the viscosity increases.

Question 18

Which of the alignments below was made with an affine gap penalty? Motivate your answer.

Alignment 1
ATCTAGTGTATAGTACATGCA
ATCTAG——-TACATGCA

Alignment 2
ATCTAGTGTATAGTACATGCA
ATGTA–G–TA—CATGCA

Answer 18

Affine gap penalty goes by the following function:

A + B*L.
- A = Gap opening penalty
- B = Nucleotide missing penalty
- L = length

A is usually higher than the continuing nucleotides which are missing due to them likely leading to the same functional defecit. With this knowledge, alignment 1 is likely due to affine gap penalty, as alignment 2 would have been punished severely for it’s 3 gaps vs 1 big gap.

The gap opening penalty is usually high, but not necessarily. You set the gap penalties empirically.

Question 19

Illumina next-generation sequencing (NGS) technology uses clonal amplification and sequencing by synthesis (SBS) chemistry to enable rapid, accurate sequencing. This NGS technology can be used in different applications. Briefly explain the following applications:

a) Whole-genome resequencing (2p)

b) RNA_Seq (2p)

c) ChIP-Seq (2p)

Answer 19

a) Illumina sequencing can be used to resenquence genome using its patented bridge amplification method. The result of bridge amplification is thousands of DNA fragments which are associated to adapters. By having a sequence to compare the dfragments to, they are aligned. The alignment process is made easier by the pair-ended reads which illumine can generate. That way you know the adapter length / identity, as well as the read length.

b) RNAseq works identically to how DNAseq would. The transcripts are not necessarily pieced together, but rather, the relative transcript amounts are generated.

c)ChIP seq is when you sequence the DNA which you’ve probed and captured with an antibody.

Question 20

Which are the key components of the bacterial T7 recombinant protein production system?

Answer 20

1. T7 is promoted by the lac-promoter. The promoter is repressed by lacI until lactose or IPTG is present.
2. If lactose/IPTG is present, T7 polymerase is transcribed and translated, it can now go on and bind to its promoter.
3. T7 binds to the plasmid which has been transformed into the bacteria, transcribes the contents, which also include lacI, which will then repress T7.
4. Tighter regulation can be achieved by transforming a T7 lysozyme plasmid which is promoted by T7, and then creates a lysozyme which breaks down the remiaing active polymerase at the same time as lacI represses the new-formation of the polymerase.

Question 21

(MC/1p) Write the formula that you should use for calculation of the relative centrifugal field (RCF).

Answer 21

1.12e-5(RPM)^2 * r

Question 22

Order the folling RNA based on abundance in the cells: rRNA, mRNA, tRNA.

Answer 22

rRNA (70-80%)
tRNA (15%)
mRNA (1-5%)

Question 23

What differentiates plant RNA from human and bacterial RNA when running them on an agarose gel?

Answer 23

Human RNA: 18s (1.9kb), 28s (5 kb) are present.

Bacterial RNA: 16s (2.9),23s (2.5kb) are present.

Plant RNA: 16s, 18s, 23s, 25s are present.

Question 24

On an agarose gel where RNA is ran, where would you find degraded RNA?

Answer 24

At the bottom of the samples’ wells (they run fast and cause a smear).

Question 25

On an agarose gel where RNA is ran, where would you find any remaining DNA?

Answer 25

DNA would be found in (hopeully) a very small quantity on the top of the gel.

Question 26

Where would you find ncRNA and mRNA in an agarose gel loaded with all cellular RNA?

Answer 26

ncRNA are very small RNAs, you’d find them near the bottom.

mRNAs: Depending on what organism you’re looking at, you can identify the pronounced rRNAs and navigate from them. In human RNA, you’ll find 18s (1.9kb) and 28s (5kb). In relation to these rRNAs, the mRNAs would have ran longer than 18s (they are 200-1000 bp long).

Question 27

The following 3 primers are made in order to illustrate one design error each. Which are these? Also describe what consequence each design error should have for the (1) efficiency (direct or indirect) and the (2) specificity of production of the wanted product in a PCR reaction (with a suitable counter primer)? Motivate!
NB! These primers are not supposed to be used together in pairs, but you should evaluate them one-by-one.

a) 5’-TAGTATCAGGTACATCGCGAT-3’

b) 5’-CACACTCCCAATCCTTACTC-3’

c) 5’-AGTCAGTCAGTCAGTCAGTC-3’

Answer 27

a) There are 8 GCs (31%). This is low. The low GC content –> Low annealing stability –> Low Tm.

b) There are no G’s present in the primer. Simple regions ma lead to a strand 2D structure (non-linear primer) (?)

c) There are repeats of CAG TCA AGT GTC. Simple repeats can generate secondary binding sites for primers. Stable hybridization to secondary binding sites results in nonspecific amplification. Repeats >3-4.

Maybe? Idk feller.

Question 28

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each)

a) It/they can (directly or indirectly) give you a fully quantitative (i.e. not “semi-quantitative”) measure of mRNA levels

Answer 28

RNA seq, RT-PCR (using spike in transcripts and competitive product amplification respectively)

Question 29

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each)

c) It has the highest sensitivity in quantifying low-abundance mRNAs

Answer 29

RNAseq, more specifically - FLASHSEQ (FS)

https://www.nature.com/articles/s41587-022-01312-3

Question 30

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each)

d) It/they can tell you where inside a cell that an mRNA is present

Answer 30

In situ hybridization
Reporter gene analysis (i interpret reporter genes as being overexpressed genes w/ fluorescence characteristics which can be traced within a cell. In order for them to work, you’d likely want to KO the endogenous mRNA).

Question 31

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each)

e) It/they can be used to give a measure of the in vivo activity of a promoter

Answer 31

Reporter gene analysis. You generate transgenic animals which host the gene, this can LIKELY be done with CRISPR/cas or Cre-LoxP reccombination.

Question 32

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each)

g) It/they can tell you the length of one or several mRNAs at the same time that it is quantified

Answer 32

RNAseq?

It cant be in situ hybridisation, northern blotting or reporter gene assay. I don’t think it can be RT-PCR either since the fluorescence is non-specific to the elongted transcript. If you use taqman probes / molecular beacons you would get an idea, but norel confirmation to the length of the amplicon.

Question 33

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each)

h) It/they is/are direct methods of RNA detection

Answer 33

In situ hybridisation.
- Hybrdigises directly to the RNA

RNA seq
- The direct RNA sequencing platform offered by Oxford Nanopore Technologies allows for direct measurement of RNA molecules without the need of conversion to complementary DNA, fragmentation or amplification. As such, it is virtually capable of detecting any given RNA modification present in the molecule that is being sequenced, as well as provide polyA tail length estimations at the level of individual RNA molecules.

Question 34

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each)

It/they can quantify splicing variants

Answer 34

RNA seq

RT-PCR
- Design primer for exon.

Question 35

Mark each statement below. Write True if it is completely correct. Mark it FALSE if it is wrong in one or several aspects, and underline the word or words that make it wrong. (1p per statement)

Knock-in is just another term for standard over-expression.

Answer 35

It’s not a standard overexpression. A knock-in means that ou REPLACE the endogenous gene with another copy. It’s often used to model diseases.

Question 36

c) Assume that you want to introduce a specific change in your gene of interest, for example change it to an allele with one base substitution at a specific position of the gene. What do you need to do to get such a specifc change into the chromosomal locus after the dsDNA break has been introduced by CRISPR/Cas9? What mechanism in the cell would be involved? (1.5p)

Answer 36

I would generate a dsDNA break w/ CRISPR/Cas9. I would then transfect a repair templatewhich hosts the substitution as well as a screenable marker. Another way to generate the substitution would be by making CRISPR/cas9 catalytically dead and conjugate an enzyme which changes nts, like cytosine deaminase which turns C –> U –> T.

Question 37

You have genetically modified mouse embryonic stem cells to express a fluorescently tagged protein and you would like to obtain transgenic mice that stably express the protein throughout their whole body. You have a female mouse that was fertilized three days ago, as well as a female mouse that was treated with hormones to be pseudo-pregnant. Describe how you would obtain a stably transformed fully transgenic mouse.

Answer 37

Viral vector or via microinjection of DNA. The genetic material will be incorporated via NHEJ. You could also use programmable nucleases that cause dsDNA break which will be repaired by co-transformed repair template.

https://blog.addgene.org/mouse-modeling-part-1-genetically-engineered-mice

Question 38

What is the name of the plot used by crystallographers to map different zones of crystal growth? [1 point]

Answer 38

Phase diagram.

Question 39

Name two methods for preparing crystallization drops that are commonly used. [0.5 + 0.5 points]

Answer 39

Batch

Vapour diffusion

Dialysis

Question 40

Name the two ways that neutrons can be produced in large scale research facilities. [0.5 + 0.5 points]

Answer 40

1. Decay of U235 –> neutrons grathered becore they facilitate further decay.
2. Spallation source. Collide atoms so that they break, collect neutrons.

Question 41

How do we prepare deuterium-labeled proteins for neutron scattering? [1 point]

Answer 41

You can achieve deuterisation by producing the protein in absence of hydrogen. The cells must metabolise deuterium and produce their cellular components using it instead of hydrogen. It is achieved by having D2O, sugars hosting deuterium and so on.

Question 42

Q1 (1 p) Which natural physical principle underlies production of the radiation used at MAX IV. What is it called and how is it produced?

Answer 42

Synchrotron radiation: Electromagnetic radiation is generated when particles are accelerated radially.

Question 43

Q3 (2 p) How do you envision MAX IV can become a tool in your own research or on a research case that you know or could imagine? Mention the research field to which the project will belong to, the fundamental kind of information that you could obtain from the measurements and if possible, a hint on why or for what that could be useful or important.
Example: Solar energy. Identify and optimize (bandgap and stability) suitable quantum dots (QDs) for solar cells.

Answer 43

Drug development. You would be able to characterize the electrostatic interactions which occur throughtout the pharamceutical compound. Electrons / photons.