Exam 3 Review

Question 1

Name the three ways that molecules/organelles travel to the lysosome for degradation

Answer 1

1. phagocytosis 2. autophagy 3. endocytosis

Question 2

Which of these three does not involve importing something from outside the cell?

Answer 2

Autophagy

Question 3

Given below is the sense strand of a DNA sequence to be transcribed into mRNA, which will be translated into protein.5’ ATGGCATAATCGTGTTTGAA 3’

Based on this sequence, give the corresponding mRNA transcript. Indicate polarity.

Answer 3

5’ AU GGC AUA AUC GUG UUU GAA 3’

Question 4

5’ ATGGCATAATCGTGTTTGAA 3’

This particular DNA sequence codes for the middle of a polypeptide. Translate the mRNA using the genetic code provided. Give amino acid sequence in the one-letter code provided.

Answer 4

G-I-I-V-F-E

Question 5

To ensure that the surface area of the plasma membrane remains constant, the rates of _____________ and __, _____________ must be equal.

Answer 5

endocytosis & exocytosis, secretion

Question 6

What trait (property) was genetically engineered into the crop in this case?

Answer 6

Glyphosate resistance, Roundup resistance, Roundup Ready crops

Question 7

What is the major issue (big question) in this case? (1sentence)

Answer 7

Can a life (gene) form be patented?

Question 8

Assume Ran-GAP is mutated to a nonfunctional protein.Where will importin accumulate?

Answer 8

cytosol

Question 9

________ are a family of proteins that assist in folding newly synthesized polypeptides. These proteins use energy in the form of ___________ to fold polypeptides. If a cytosolic polypeptide cannot be folded correctly, it is covalently bonded to (tagged with) an oligopeptide named ______________, which targets the misfolded polypeptide to the_____________, where it is broken down into smaller peptides and amino acids.

Answer 9

Chaperones (HSP), ATP, ubiquitin, proteasome

Question 10

Put the following events in the correct order concerning eukaryotic translation.
(A.) Peptidyltransferase reaction (B). Release factor recognizes stop codon (C). Small subunit with bound tRNAMet binds to mRNA (D). Charged tRNA correctly base pairs with codon at A site (E). Small subunit of ribosome moves one codon downstream

Answer 10

C, D, A, E, B

Question 11

Which of the steps listed above (A – E) require nucleotide hydrolysis?

Answer 11

D. Charged tRNA correctly base pairs with codon at A site; E. Small subunit of ribosome moves one codon downstream

Question 12

Which nucleotide provides this energy?

Answer 12

GTP

Question 13

This polypeptide is destined to reside in the lysosomal membrane. What additional address label (targeting motif) must be added to the polypeptide?

Answer 13

Mannose-6-P

Question 14

In what organelle is this address label added?

Answer 14

Golgi

Question 15

What does the selectable marker on a cloning plasmid code for? How is this useful in generating transgenic organisms?

Answer 15

Antibiotic resistance. Following transformation, only cells containing the plasmids grow in the presence of the antibiotic

Question 16

Many restriction endonucleases cut at palindromes and form ‘sticky ends’. What are sticky ends and how are they useful in cloning?

Answer 16

Sticky ends = staggered cut in DNA. Cloning - Cut vector and DNA to be cloned with same restriction endonuclease and sticky ends of the two DNAs base pair.

Question 17

What enzyme, other than a restriction endonuclease, is needed to clone a segment of DNA into a plasmid?

Answer 17

DNA ligase; Ligase seals the nicks

Question 18

Point mutation in germ line

Answer 18

Single base mutation within anexon passed to offspring

Question 19

Altered transcription rate

Answer 19

Two base deletion in the regulatory region of a gene

Question 20

Gene Duplication (and divergence)

Answer 20

Generates gene families, This process has created proteins that share domains

Question 21

Exon Shuffling

Answer 21

This process has created proteins that share domains , Recombination between different genes, Generates gene families

Question 22

Horizontal gene transfer

Answer 22

Movement of DNA between different species

Question 23

What two things does Sar1 do to drive (help) vesicle formation?

Answer 23

1.Induce membrane curvature, 2.Recruit COPIIs

Question 24

Where is Sar1-GEF located?

Answer 24

ER membrane

Question 25

What enzyme hydrolyzes GTP to remove Sar1 from the membrane?

Answer 25

Sar1

Question 26

contracted HIV. His wife, also a cell biologist, has recently discovered a new molecule which she isolated from the bark of a tree which can be used to treat HIV! This molecule blocks the binding site on the Rev protein and prevents it from binding to the virus’ RNA genome.

Explain why this molecule could be used as medicine to treat HIV.

Answer 26

Blocking the Rev binding site would prevent the Rev from binding to the vRNA. Because the Nuclear Export Signal is on Rev, the vRNA cannot move out of the nucleus to infect other cells unless Rev is allowed to bind.

Question 27

Imagine a mutation in the gene coding for BiP, an ER chaperone. The mutation creates a premature stop codon resulting in the deletion of the last 4 amino acids (the 4 amino acids at the COOH terminus).

Is this mutation likely to prevent the mutant BiP protein from entering the ER lumen? Why or why not

Answer 27

No, signal sequence not affected

Question 28

Assuming the mutation doesn’t affect the folding of BiP, what is the likely final destination of the mutant protein? Why?

Answer 28

Secreted, KDEL is gone

Question 29

If the mutation did affect folding of BiP, what transcriptional program might be activated?

Answer 29

UPR

Question 30

What general category (type) of transposon is still capable of moving (transposition) in the human genome?

Answer 30

Retrotransposon

Question 31

Name one enzyme coded for by this type of transposon.

Answer 31

RNA polymerase, reverse transcriptase, transposase

Question 32

Contains an N-terminal mitochondrial signal sequence and internal stop transfer sequence.

Answer 32

MITO INNER MEMBRANE

Question 33

Contains no signal or targeting sequences.

Answer 33

CYTOSOL

Question 34

Contains an internal ER signal sequence, and a KKXX sequence at the C terminus.

Answer 34

ER, GOLGI (plasma membrane)

Question 35

Contains, an N-terminal ER signal sequence, then an internal mitochondrial signal sequence, and finally a lysosomal targeting sequence near the C terminus.

Answer 35

(Endosome) Lysosome

Question 36

Contains an internal NLS and KDEL at the C terminus.

Answer 36

Cytosol, Nucleus

Question 37

What is Gene Replacement?

Answer 37

In regards to Genetically Engineered Organisms, technique that substitutes mutant form of gene for its normal counterpart.

Question 38

What is Gene Knockout?

Answer 38

specific gene is inactivated.

Question 39

What is Gene addition?

Answer 39

insert active copy of another gene, both are active. (active original gene could be defective)

Question 40

What happens during misalignment of gene duplication crossover?

Answer 40

unequal crossover. One chromosome is longer with both genes, the other is short with none.

Question 41

What happens during exon duplication and shuffling?

Answer 41

exon shuffling moves domains between genes.