Evolution & Medicine-36

Question 1

HIV AIDS

Answer 1

lentivirus.
Infection occurs through bodily fluids.
Virus infects and causes the failure of the immune system

Question 2

Sequencing Virus

HIV is a virus, and has a genome

Answer 2

Genome is often inserted into the human genome in
infected cells.
Using PCR you can isolate viral genomes, or pieces of viral genomes, from infected patients

Question 3

Species 1:
ACGCTAGTTTTAGCTAGCACCAAGTG
Species 2:
AGGCTAGGTTTAGATAGCACAAAGTA
Species 3:
ACGATAGTTTTAGCTACCACCAAGTA

Draw a Phylogenetic tree
Which species are more related?

Answer 3

Species 1 & 3

Question 4

Draw a tree of HIV sequences

Multiple sequences come from each patient.
Are the sequences more closely related within a patient than they are to sequences from other patients?

Answer 4

Yes

Question 5

Infections from multiple viruses.

Each patient may have more than one viral sequence because they were infected with multiple viruses.

• Evidence for?
• Evidence against?

Answer 5

• Multiple sequences, infection from a ‘bulk source’.
• the pattern of the tree - if there were multiple infections, why are viruses within patients more similar than viruses
  between patients?

Question 6

What explains the pattern?
from Tree of HIV sequences
sequences are more closely
related within a patient than to sequences from other patients.

Answer 6

Infections from multiple Viruses

The Viruses are changing

Question 7

The Viruses are changing

The multiple sequences may be due to the viruses changing within a patient.

• Evidence for:
• Evidence against:
• Prediction:

Answer 7

• Viruses within a patient are more similar than between. The pattern of the tree suggests a single point entry of a virus, and then diversification.
• Patient 91 has virus in two parts of the tree
• If the viruses are changing then if we sample a patient
  successively then we should see different viral sequences appearing.

Question 8

Why HIV sequence changes?

two explanation

Answer 8

Proximate

Ultimate

Question 9

Proximate

Answer 9

By what mechanism is the change occurring?

Question 10

Ultimate

Answer 10

What is causing the change?

Question 11

Mechanism of change

What do we know about HIV that might explain the
mechanism by which its sequence changes?

Answer 11

HIV is a lentivirus – a sort of retrovirus
It has an RNA genome
Infects and damages immune system cells

Question 12

Reverse Transcription

Answer 12

an enzyme that turns RNA
sequence back into DNA.
more error prone than DNA
replication.
HIV genome is RNA, but is turned into DNA to insert in
the genome.
 lots of variants are formed

Question 13

Is HIV Virus just a mutation? and why?

Answer 13

no it’s also evolution
reverse transcriptase is error-prone
So lots of variants arise
do not find inactivating mutations; all the variants found encode active, working viruses.

Question 14

Is HIV Virus Evolution?

Answer 14

Variation
Inheritance
Selection
Time

Question 15

HIV Virus Evolution?

Variation?

Answer 15

Yes, Sorted by the error-prone nature of HIV reverse transcription

Question 16

HIV Virus Evolution?

Inheritance?

Answer 16

Yes
HIV viruses pass on their RNA
after being inserted in the genome

Question 17

HIV Virus Evolution?
Selection?
What selects for or against HIV variants?

Answer 17

• The immune system
• Drug regimen
• Changes in the receptor
• Tropism in tissues

Question 18

HIV Virus Evolution?

Time?

Answer 18

HIV lifecycle is very fast, so in the course of an infection there is plenty of time for evolution.

Question 19

Do viruses evolve differently if you put a patient on anti-retroviral drugs?

Answer 19

AIDS viruses from patients on anti-retrovirals have a different
pattern of variation from those that are not.
Most clear is the advent of resistant viruses – first to AZT, now to ripple therapy or HAART (high active retroviral therapy)

Question 20

The HIV genome holds the record for the fastest evolving thing we know of
Does it matter?

Answer 20

Patients don’t have a virus, they have a vast armada of viral variants
Resistance to therapy, even complex therapy, arises rapidly
Making effective vaccines is incredibly hard

Question 21

The HIV Armada

Answer 21

Estimates of 10^8 -5 x 10^30 provirus containing cells in a patient
Each one may be genetically distinct, so assuming 1 provirus / cell we have up to 5 x 10^10 different variants

Question 22

Is HIV Virus an isolated case?

Answer 22

Many pathogens evolve within the host in the same way

The antibiotic resistance spreading through a population of bacteria is also an evolutionary process

Even our own genome evolves in response to pathogens e.g. CFTR variants as possible resistance to plague

Question 23

Evolutionary thinking can help us understand and better respond to

Answer 23

pathogens like HIV

Question 24

Evolution is a key way that

Answer 24

pathogens respond to hosts and therapy.
one instance where
evolution is part of our
understanding of disease