DNA & RNA Study Guide (Exam Review #95-126)

Question 1

What is transformation?

Answer 1

A strand of bacteria being changed by the genetic code of another

Question 2

What conclusion did Avery make concerning DNA?

Answer 2

It stores genetic material

Question 3

What is a bacteriophage?

Answer 3

A virus that infects bacteria

Question 4

What did Hershey-Chase conclude about the genetic material of a bacteriophage?

Answer 4

It is in its DNA.

Question 5

DNA is composed of long repeating subunits called what?

Answer 5

Nucleotides

Question 6

What are the three parts of a nucleotide?

Answer 6

1. Nitrogenous base 2. 5-Carbon sugar 3. Phosphate group`

Question 7

What are the 4 nitrogenous bases that make up DNA?

Answer 7

Adenine Thymine Guanine Cytosine

Question 8

The backbone of the DNA molecule is made of what?

Answer 8

Deoxyribose and phosphate group

Question 9

Name 2 purines.

Answer 9

Adenine and Guanine

Question 10

Name 2 pyrimidines.

Answer 10

Thymine and Cytosine

Question 11

What is Watson and Crick’s model of the DNA molecule shaped like?

Answer 11

A double helix

Question 12

Describe a double helix.

Answer 12

Twisted ladder

Question 13

In DNA, Adenine pairs with…

Answer 13

Thymine

Question 14

In DNA, Guanine pairs with…

Answer 14

Cytosine

Question 15

In DNA, Cytosine pairs with…

Answer 15

Guanine

Question 16

In DNA, Thymine pairs with…

Answer 16

Adenine

Question 17

Where is the genetic material located in a prokaryotic cell?

Answer 17

The cytoplasm

Question 18

The DNA of a eukaryotic cell is located where?

Answer 18

Nucleus

Question 19

In what form is the DNA of a eukaryotic cell stored?

Answer 19

Chromatin

Question 20

Do all organisms have the same number of chromosomes?

Answer 20

No

Question 21

In the nucleus of a cell, the DNA and protein forms a…

Answer 21

Chromatin

Question 22

The proteins in the chromosomes are called…

Answer 22

Histones

Question 23

DNA and histone molecules constitute a…

Answer 23

Nucleosome

Question 24

What do nucleosomes do?

Answer 24

Fold and store DNA

Question 25

Each strand of DNA is said to be complementary. What does this mean?

Answer 25

They are matched by base pairing.

Question 26

What happens during DNA replication?

Answer 26

DNA is copied. DNA polymerase is the enzyme that "unzips" it.

Question 27

What is the complementary DNA strand? ATCGTAAG

Answer 27

TAGCATTC

Question 28

What is the complementary DNA strand? TATAGGGGACATCATCAGGCGCTCGTTCGT

Answer 28

ATATCCCCTGTAGTAGTCCGCGAGCAAGCA

Question 29

What is used to separate the strands of DNA before replication?

Answer 29

Enzymes (DNA polymerase)

Question 30

Define Gene.

Answer 30

A sequence of DNA that codes for a protein

Question 31

Describe the 3 main differences between DNA and RNA.

Answer 31

DNA - Deoxyribose - Thymine - Double-stranded RNA - Ribose - Uracil - Single-stranded

Question 32

Name the three types of RNA.

Answer 32

Messenger, transport,and ribosomal

Question 33

Describe the role of mRNA during protein synthesis.

Answer 33

It copies part of DNA and takes it to the ribosomes

Question 34

Describe the role of tRNA in protein synthesis.

Answer 34

It brings amino acids to the ribosomes to form polypeptides.

Question 35

What is the name of the process in which RNA copies the DNA molecule?

Answer 35

Transcription

Question 36

What does RNA polymerase do?

Answer 36

It "unzips" the DNA for the RNA to make a copy.

Question 37

Define promoter.

Answer 37

Proteins in the DNA that indicate where to start and stop

Question 38

Define introns.

Answer 38

Extra, non-essential bases

Question 39

Define exons.

Answer 39

Useful bases

Question 40

A chain of amino acids is called a...

Answer 40

Polypeptide

Question 41

What is a codon?

Answer 41

A group of 3 bases on the mRNA

Question 42

What are stop codons?

Answer 42

Codons that end a protein (polypeptide chain)

Question 43

Where are proteins manufactured in the cell?

Answer 43

Ribosomes

Question 44

The decoding of mRNA into a polypeptide chain is called...

Answer 44

Translation

Question 45

Define anticodon.

Answer 45

The complementary bases on tRNA to those on the mRNA

Question 46

Describe the relationship between proteins and genes.

Answer 46

Genes are involved in making proteins.

Question 47

What are mutations?

Answer 47

Changes in genetic material

Question 48

What are point mutations?

Answer 48

Mutations involving one or a few nucleotides

Question 49

What is an insertion?

Answer 49

Adding a base

Question 50

What is a deletion?

Answer 50

Losing a base

Question 51

What happens during a frameshift mutation?

Answer 51

The "reading frame" is shifted which causes a lot of changes in the amino acids

Question 52

How can a frameshift mutation affect a protein?

Answer 52

It can change every amino acid and essentially make a different protein.

Question 53

Define inversion.

Answer 53

A reversal of parts of the chromosomes

Question 54

Define translocation.

Answer 54

Part of a chromosome breaks off and attaches somewhere else.

Question 55

What is polyploidy?

Answer 55

The condition in which an organism has extra sets of chromosomes.

Question 56

During the growth of an embryo, cell differentiation occurs. What is cell differentiation?

Answer 56

It's the specialization of cells.

Question 57

Given top DNA, find bottom DNA, mRNA, tRNA, and amino acids. ATT-CGT-AAG-TTA-GAC

Answer 57

Bottom DNA: TAA-GCA-TTC-AAT-CTG mRNA: UAA-GCA-UUC-AAU-CUG tRNA: AUU-CGU-AAG-UUA-GAC Amino acids: Stop, Alanine, Phenylalanine, Asparagine, Leucine