DNA & RNA Study Guide (Exam Review #95-126) Flashcards
What is transformation?
A strand of bacteria being changed by the genetic code of another
What conclusion did Avery make concerning DNA?
It stores genetic material
What is a bacteriophage?
A virus that infects bacteria
What did Hershey-Chase conclude about the genetic material of a bacteriophage?
It is in its DNA.
DNA is composed of long repeating subunits called what?
Nucleotides
What are the three parts of a nucleotide?
- Nitrogenous base 2. 5-Carbon sugar 3. Phosphate group`
What are the 4 nitrogenous bases that make up DNA?
Adenine Thymine Guanine Cytosine
The backbone of the DNA molecule is made of what?
Deoxyribose and phosphate group
Name 2 purines.
Adenine and Guanine
Name 2 pyrimidines.
Thymine and Cytosine
What is Watson and Crick’s model of the DNA molecule shaped like?
A double helix
Describe a double helix.
Twisted ladder
In DNA, Adenine pairs with…
Thymine
In DNA, Guanine pairs with…
Cytosine
In DNA, Cytosine pairs with…
Guanine
In DNA, Thymine pairs with…
Adenine
Where is the genetic material located in a prokaryotic cell?
The cytoplasm
The DNA of a eukaryotic cell is located where?
Nucleus
In what form is the DNA of a eukaryotic cell stored?
Chromatin
Do all organisms have the same number of chromosomes?
No
In the nucleus of a cell, the DNA and protein forms a…
Chromatin
The proteins in the chromosomes are called…
Histones
DNA and histone molecules constitute a…
Nucleosome
What do nucleosomes do?
Fold and store DNA
Each strand of DNA is said to be complementary. What does this mean?
They are matched by base pairing.
What happens during DNA replication?
DNA is copied. DNA polymerase is the enzyme that “unzips” it.
What is the complementary DNA strand? ATCGTAAG
TAGCATTC
What is the complementary DNA strand? TATAGGGGACATCATCAGGCGCTCGTTCGT
ATATCCCCTGTAGTAGTCCGCGAGCAAGCA
What is used to separate the strands of DNA before replication?
Enzymes (DNA polymerase)
Define Gene.
A sequence of DNA that codes for a protein
Describe the 3 main differences between DNA and RNA.
DNA - Deoxyribose - Thymine - Double-stranded RNA - Ribose - Uracil - Single-stranded
Name the three types of RNA.
Messenger, transport,and ribosomal
Describe the role of mRNA during protein synthesis.
It copies part of DNA and takes it to the ribosomes
Describe the role of tRNA in protein synthesis.
It brings amino acids to the ribosomes to form polypeptides.
What is the name of the process in which RNA copies the DNA molecule?
Transcription
What does RNA polymerase do?
It “unzips” the DNA for the RNA to make a copy.
Define promoter.
Proteins in the DNA that indicate where to start and stop
Define introns.
Extra, non-essential bases
Define exons.
Useful bases
A chain of amino acids is called a…
Polypeptide
What is a codon?
A group of 3 bases on the mRNA
What are stop codons?
Codons that end a protein (polypeptide chain)
Where are proteins manufactured in the cell?
Ribosomes
The decoding of mRNA into a polypeptide chain is called…
Translation
Define anticodon.
The complementary bases on tRNA to those on the mRNA
Describe the relationship between proteins and genes.
Genes are involved in making proteins.
What are mutations?
Changes in genetic material
What are point mutations?
Mutations involving one or a few nucleotides
What is an insertion?
Adding a base
What is a deletion?
Losing a base
What happens during a frameshift mutation?
The “reading frame” is shifted which causes a lot of changes in the amino acids
How can a frameshift mutation affect a protein?
It can change every amino acid and essentially make a different protein.
Define inversion.
A reversal of parts of the chromosomes
Define translocation.
Part of a chromosome breaks off and attaches somewhere else.
What is polyploidy?
The condition in which an organism has extra sets of chromosomes.
During the growth of an embryo, cell differentiation occurs. What is cell differentiation?
It’s the specialization of cells.
Given top DNA, find bottom DNA, mRNA, tRNA, and amino acids.
ATT-CGT-AAG-TTA-GAC
Bottom DNA: TAA-GCA-TTC-AAT-CTG
mRNA: UAA-GCA-UUC-AAU-CUG
tRNA: AUU-CGU-AAG-UUA-GAC
Amino acids: Stop, Alanine, Phenylalanine, Asparagine, Leucine
