cell cycle and dan structure: drawings and diagrams Flashcards
Annotate a diagram of the 3D structure of the DNA molecule

Draw a nucleotide
Refer to picture

Draw a simple diagram of RNA (using circles/pentagons/rectanges)
Refer to picture

Draw a simple diagram of DNA (using circles/pentagons/rectanges)
Refer to picture
Classify the following molecular structure as purine or pyrimidine

Purine (guanine)
Classify the following molecular structure as purine or pyrimidine

Pyrimidine (cytosine)
Classify the following molecular structure as purine or pyrimidine

Pyrimidine (uracil)
Classify the following molecular structure as purine or pyrimidine

Purine (adenine)
Classify the following molecular structure as purine or pyrimidine

Pyrimidine (thymine)
With the help of a diagram, explain the process of DNA replication
- Helicase uncoils the DNA
- RNA primase adds short sequences of RNA to both strands (the primer)
- The primer allows DNA polymerase III to bind and start replication
- DNA polymerase III adds nucleotides to each template strand in a 5’→3’ direction
- These nucleotides are initially deoxyribonucleoside triphosphates but they lose two phosphate groups during the replication process to release energy
- One strand is replicated in a continuous manner in the same direction as the replication fork (leading strand)
- The other strand is replicated in fragments (Okazaki fragments) in the opposite direction (lagging strand)
- DNA polymerase I removes the RNA primers and replaces them with DNA
- DNA ligase then joins the Okazaki fragments together to form a continuous strand

Draw a diagram to illustrate PCR
Refer to picture
Draw a labelled diagram to illustrate the process of trancription
Refer to picture

Refering to the RNA codon table, deduce the amino acid sequence that corresponds to the following mRNA sequence:
AUGCGCGCGAGGUAA
Met Arg Ala Arg STOP
Refering to the RNA codon table, deduce the mRNA codons for tryosine (Tyr).
UAU / UAC
Refering to the RNA codon table, deduce the amino acid sequence that will be coded for given the following mRNA sequence: GUAUGCACGUGACUUUCCUCAUGAGCUGAU
Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U Answer: (amino acid) Met His Val Thr Phe Leu Met Ser STOP
Draw an annotated diagram of tRNA
The acceptor stem (3’-CCA) carries an amino acid
The anticodon associates with the mRNA codon (via complementary base pairing)
The T loop associates with the ribosome (via the E, P and A binding sites)
The D loop associates with the tRNA activating enzyme (responsible for adding the amino acid to the acceptor stem)

Draw a labelled diagram of a eukaryotic ribosome
Refer to picture
With the help of a diagram, explain the process of translation
- translation is the synthesis of polypeptides on ribosomes
1. Initation - mRNA molecule binds to the small ribosomal subunit at an mRNA binding site
- an initiator tRNA molecule carrying methionine binds at the start codon ‘AUG’ in the P site
- the next codon signals another tRNA to bind, which occupies the A site
- a peptide bond is formed between the amino acids in the P and the A site
2. Elongation - the ribosome translocates three bases along the mRNA, moving the tRNA in the P site to the E site, freeing it and allowing a tRNA with the appropriate anticodon to bind to the next codon and occupy the vacant A site
- the process repeats until termination
3. Termination - a stop codon is reached, terminating translation
- the free polypeptide is released

Identify the structure shown in the following electron micograph
polysomes
Label the following diagram of a polysome

Refer to picture
Identify the secondary structure of the protein

Alpha helices
Identify the secondary structure of the protein

Beta-pleated
Label the diagram to show the possible interactions contributing to tertiary structure

Refer to picture
Annotate a diagram of the quaternary structure of hemoglobin

Refer to picture