Week 3 Flashcards
A nucleotide is made of which of the following chemical components?
a) a nitrogenous base, an amino acid, and a pentose sugar
b) a series of nitrogenous bases, a nucleic acid backbone, and a hexose sugar
c) a nitrogenous base, a fatty acid, and an amino acid
d) a nitrogenous base, a phosphate group, and a pentose sugar
e) a nitrogenous base, an amino acid, and a phosphate group
d) a nitrogenous base, a phosphate group, and a pentose sugar
The “beads on a string” seen in interphase chromatin are __________.
a) histone tails
b) looped domains
c)nucleoids
d) heterochromatin
e) nucleosomes
e) nucleosomes
Which binding site on a ribosome holds a tRNA attached to a growing polypeptide chain?
a) None of the listed responses are correct.
b) E site
c) P site
d) A site
e) The P site, A site, and E sites all hold tRNA attached to polypeptides.
c) P site
Transcription involves the transfer of information from __________.
a) RNA to DNA
b) DNA to RNA
c) DNA to an amino acid sequence
d) the nucleus to the cytoplasm
e) mRNA to an amino acid sequence
b) DNA to RNA
Which of the following is not involved in the formation of a eukaryotic transcription initiation complex?
a) TATA box
b) Transcription factors
c) Promoter
d) RNA polymerase II
e) Small RNA molecules
e) Small RNA molecules
Which of these is a false statement?
a) Mitochondria are involved in energy metabolism.
b) The folds of the inner mitochondrial membrane are called cristae.
c) Mitochondria have more than one membrane.
d) The mitochondria possess their own DNA.
e) Mitochondria contain ribosomes in the intermembrane space.
e) Mitochondria contain ribosomes in the intermembrane space.
RNA polymerase __________.
a) is the enzyme that catalyzes the joining of each amino acid to the right tRNA
b) is a ribozyme
c) is the molecule of which ribosomes are constructed
d) moves along the template strand of DNA, elongating an RNA molecule in a 5′ → 3′ direction
e) is the enzyme that transcribes exons but does not transcribe introns
d) moves along the template strand of DNA, elongating an RNA molecule in a 5′ → 3′ direction
Which is/are possible site(s) of protein synthesis in a typical eukaryotic cell?
a) the rough endoplasmic reticulum
b) in mitochondria
c) The cytoplasm, in mitochondria and the rough endoplasmic reticulum.
d) the cytoplasm
e) the cytoplasm and the rough endoplasmic reticulum
c) The cytoplasm, in mitochondria and the rough endoplasmic reticulum.
How is the information encoded in DNA actually used by organisms?
a) DNA serves as a template upon which proteins are assembled.
b) The information in DNA is transcribed to RNA and then translated into protein.
c) DNA leaves the nucleus and interacts directly with other molecules in the cytoplasm.
d) DNA is the molecular building block of proteins.
e) DNA is translated into protein and then transcribed to RNA
b) The information in DNA is transcribed to RNA and then translated into protein.
Transfer RNA __________.
a) is produced in the nucleolus
b) tags a growing polypeptide for export to the endoplasmic reticulum
c) binds to its specific amino acid in the active site of an aminoacyl-tRNA synthetase
d) is translated into protein
e) has catalytic activity and is thus a ribozyme
c) binds to its specific amino acid in the active site of an aminoacyl-tRNA synthetase
Which of the following is not part of the translation initiation complex?
a) Large ribosomal subunit
b) Small ribosomal subunit
c) TATA box
d) Initiator tRNA
e)mRNA
c) TATA box
Which of the following is true of transcription factors?
a) Transcription factors bind to promoters.
b) Transcription factors are present in eukaryotic cell nuclei.
c) All of the listed responses are correct.
d) Transcription factors are proteins.
e) Transcription factors are produced in a cell as a result of both gene transcription and translation.
c) All of the listed responses are correct.
. Which enzyme synthesizes tRNA?
a) Reverse transcriptase
b) DNA polymerase
c) Aminoacyl-tRNA synthetase
d) RNA polymerase
e) Ribosomal RNA
d) RNA polymerase
How is the template strand for a particular gene determined?
a) It is established by the presence of the promoter.
b) It is the DNA strand that runs from the 3′ → 5′ direction.
c) It is signaled by a polyadenylation signal sequence.
d) It doesn’t matter which strand is the template because they are complementary and will produce the same mRNA.
e) It is the DNA strand that runs from the 5′ → 3′ direction.
a) It is established by the presence of the promoter.
A nucleotide deletion early in the coding sequence of a gene would most likely result in ________.
a) All of the listed choices are correct.
b) a nonfunctional protein
c) multiple missense mutations
d) a frameshift mutation
e) a nonsense mutation
a) All of the listed choices are correct.
Eukaryotic DNA replication overall has very high fidelity. Which of the following phenomena or processes contributes to this high fidelity?
a) all of the above
b) proofreading
c) base pairing
d) relatively slow speed of replication
e) mismatch repair
a) all of the above
Which of the following would typically NOT be used to clone DNA?
a) DNA
b) telomerase
c) restriction enzyme
d) plasmid vector
b) telomerase
Arrange the following items in order from largest to smallest size: nucleosome, histone, metaphase chromosome, 30 nm looped fiber.
a) histone, nucleosome, 30 nm looped fiber, metaphase chromosome
b) metaphase chromosome, 30 nm looped fiber, nucleosome, histone
c) nucleosome, histone, 30 nm looped fiber, metaphase chromosome
d) histone, nucleosome, metaphase chromosome, 30 nm looped fiber
e) 30 nm looped fiber, histone, nucleosome, metaphase chromosome
b) metaphase chromosome, 30 nm looped fiber, nucleosome, histone
To “sequence” DNA means to_________.
a) disassemble the DNA molecules
b) allow two strands to base pair with each other
c) determine the order of bases in a molecule
d) arrange molecules by their relative sizes
e) replicate DNA as accurately as possible
c) determine the order of bases in a molecule
Ribosomes are the sites of translation:
false
true
TRUE
The template strand of a portion of a gene reads 3’-AACTGG-5’. What will be the sequence of a resulting transcript for this portion?
a) 3’-TTGACC-5’
b) 5’-TTGACC-3’
c) none of the above
d) 5’-UUGACC-3’
e) 3’-UUGACC-5
d) 5’-UUGACC-3’
Translation of the mRNA comes BEFORE the transcription:
false
true
FALSE
In a nucleosome, the DNA is wrapped around
a) a thymine dimer
b) polymerase molecules
c) ribosomes
d) histones
e) lysosomes
d) histones
. Which component is NOT directly involved in translation?
a) tRNA
b) ribosomes
c) GTP
d) DNA
e) mRNA
d) DNA
Protein molecules are polymers (chains) of___________.
a) sucrose molecules
b) fatty acid molecules
c) amino acid molecules
d) purines and pyrimidines
e) DNA molecules
c) amino acid molecules
Which of the following is true of a codon?
a) It can code for more than one amino acid
b) It is the basic unit of DNA structure
c) It is the basic unit of protein structure
d) It can be either in DNA or in RNA
e) It never codes for the same amino acid as another codon
d) It can be either in DNA or in RNA
What is the major difference between bacterial chromosomes and eukaryotic chromosomes?
a) The DNA of bacterial chromosomes has a slightly different structure.
b) Bacteria have a single circular chromosome, whereas eukaryotes have several linear chromosomes.
c) There is no difference between bacterial and eukaryotic chromosomes.
d) Bacterial chromosomes have much more protein associated with the DNA than eukaryotes.
e) Eukaryotes have a single circular chromosome, whereas bacteria have several linear chromosomes.
b) Bacteria have a single circular chromosome, whereas eukaryotes have several linear chromosomes.
Which structure is found in eukaryotic, but not prokaryotic, cells?
a) DNA
b) ribosomes
c) mitochondria
d) plasma membrane
e) cytosol
c) mitochondria
Which set of enzymes is involved in nucleotide excision repair?
a) nuclease, DNA polymerase, primase
b) nuclease, DNA polymerase, and ligase
c) DNA polymerase, helicase, primase
d) hydrolase, nuclease, and ligase
ligase, nuclease, and primase
b) nuclease, DNA polymerase, and ligase
One strand of a double-stranded DNA molecule has the base sequence 5’-ATAGGT-3’. The complementary base sequence on the other strand of DNA will be 3’-__________-5’.
a) UAUCCA
b) TGGATA
c) ATAGGT
d) TGGAUA
e) TATCCA
e) TATCCA
Gene cloning is crucial to any application involving one gene because __________.
a) genes occupy only a small proportion of the chromosomal DNA in eukaryotes, the rest being noncoding nucleotide sequences
b) naturally occurring DNA molecules are very long and contain many genes
c) it provides a means to produce large quantities of its protein product
d) it provides a means to produce many copies of a gene in short period of time
e) All of the listed responses are correct.
e) All of the listed responses are correct.
Bacteria use restriction enzymes to __________.
a) synthesize RNA
b) destroy foreign protein
c) destroy foreign DNA
d) synthesize protein
e) synthesize DNA
c) destroy foreign DNA
An enzyme that cuts DNA at a symmetrical sequence of bases is called __________.
a) cDNA
b) a restriction enzyme
c) palindrome
d) ligase
e) reverse transcriptase
b) a restriction enzyme
How many nucleotides are needed to code for a protein with 450 amino acids?
A. at least 150
B. at least 300
C. at least 450
D. at least 1350
E. not enough information
D. at least 1350. 450*3
How many amino acids will be in the polypeptide synthesized
from this mRNA transcript?
5’CCAAGAAUGGCGCUAAUCUAAACGCAC3’
A. 0
B. 4
C. 9
D. 7
E. Not enough information
B. 4
A gene is a sequence of DNA nucleotide bases that codes for a single protein. Approximately how many nucleotide bases would be required to code for a protein chain that is 100 amino acids long?
a) 600
b) 20
c) 100
d) 300
d) 300
Which of the following statements correctly describes mRNA processing?
a) Introns are cut out of the primary transcript and spliced together at the end of the transcript.
b) Exons are cut out of the primary transcript and transported to the endoplasmic reticulum.
c) Introns are cut out of the primary transcript and transported to the ribosomes.
d) Exons are cut out of the primary transcript, and the introns are spliced together.
e) Introns are cut out of the primary transcript, and the resulting exons are spliced together.
e) Introns are cut out of the primary transcript, and the resulting exons are spliced together.
During the transcription of a given portion of a DNA molecule __________.
a) mRNA is synthesized on both chains of the DNA molecule at once
b) half of the mRNA is synthesized on half of one chain; then the other half of the mRNA is made on the other half of the DNA
c) mRNA is synthesized on both chains of the DNA molecule, but first on one side and then the other
d) mRNA is synthesized on only one of the chains
e) any of the listed patterns may be found
d) mRNA is synthesized on only one of the chains
In many cases, more than one codon codes for the same amino acid. Because of this, we say that the code is __________.
a) incomplete
b) redundant
c) inaccurate
d) tricky
e) not specific
b) redundant
To what does the term polypeptide refer?
a) None of the listed responses are correct.
b) Amino acids linked by hydrolysis
c) Monomers linked by glycosidic linkages
d) A complex carbohydrate
e) Carbohydrates with a hydrogen bond holding them together
a) None of the listed responses are correct.
When a mutation caused by a nucleotide pair substitution occurs in a protein coding region, which of the following effects is LEAST LIKELY to occur?
a) frameshift mutation
b) missense mutation
c) silent mutation
d) nonsense mutation
e) None of the choices are correct.
a) frameshift mutation
The anticodon of a particular tRNA molecule is
a) All of the listed choices are correct
b) complementary to the corresponding triplet in rRNA
c) complementary to the corresponding mRNA codon
d) catalytic, making the tRNA a ribozyme
e) the part of tRNA that bonds with a specific amino acid
c) complementary to the corresponding mRNA codon
Each mRNA transcript codon codes for a variety of different amino acids.
True
False
FALSE
During translation, amino acid chain elongation occurs until __________.
a) no further amino acids are needed by the cell
b) the ribosome encounters a “stop” codon
c) the ribosome runs off the end of the mRNA strand
d) all tRNAs are empty
e) the polypeptide is long enough
b) the ribosome encounters a “stop” codon
The information in DNA is contained in __________.
a) the variation in the structure of nucleotides that make up the DNA molecule
b) the types of sugars used in making the DNA molecule
c) the sequence of nucleotides along the length of the two strands of the DNA molecule
d) the sequence of amino acids that makes up the DNA molecule
e) All of the listed responses are correct.
c) the sequence of nucleotides along the length of the two strands of the DNA molecule
To begin the process of gene transcription, RNA polymerase attaches to _____.
a) the promoter associated with the target gene
b) restriction sequence
c) the gene that will be transcribed
d) the operator associated with the target gene
e) None of the listed responses are correct
a) the promoter associated with the target gene
In a long random sequence of A, C, G, or U, how often should a stop codon appear?
a) Not enough information
b) 1/64
c) 1/3
d) Almost never
e) 3/64
e) 3/64
Who formulated the one gene-one enzyme hypothesis?
a) Hershey and Chase
b) Franklin
c) None of the listed responses are correct.
d) Beadle and Tatum
e) Watson and Crick
d) Beadle and Tatum
What is the proper order of the following events in the expression of a eukaryotic gene?
- translation
- RNA processing
- transcription
- modification of protein.
1, 2, 3, 4
4, 2, 3, 1
2, 3, 4, 1
1, 2, 4, 3
3, 2, 1, 4
3, 2, 1, 4
During translation in a eukaryotic cell __________.
a) mRNA is synthesized by the bonding of free nucleotides to the bases on the template strand of DNA
b) ribosomes move out of the nucleus
c) ribosomes move into the nucleus
d) tRNA carries amino acid molecules to the nucleus, where they are added to a growing polypeptide chain
e) polypeptides are synthesized at ribosomes, according to instructions carried by mRNA
e) polypeptides are synthesized at ribosomes, according to instructions carried by mRNA
The bonds that hold tRNA molecules in the correct three-dimensional shape are __________.
a) hydrogen bonds
b) covalent bonds
c) peptide linkages
d) ionic bonds
e) hydrophobic interactions
a) hydrogen bonds
The central dogma describes how the genes in the nucleus work to produce an organism’s phenotype (observable characteristics of an individual). Another way of putting it is that the central dogma follows the flow of information from _____.
a) protein to RNA
b) protein to DNA
c ) ribosomes to DNA
d) RNA to ribosomes
e) DNA to protein
e) DNA to protein
How is the information encoded in DNA actually used by organisms?
a) The information in the DNA diffuses throughout the cell.
b) DNA is translated into protein and then transcribed to RNA.
c) The information in DNA is transcribed to mRNA and then translated into protein.
d) DNA leaves the nucleus and interacts directly with other molecules in the cell.
e) Proteins are built directly from the information in the DNA.
c) The information in DNA is transcribed to mRNA and then translated into protein.
When a mutation caused by a nucleotide pair substitution occurs in a protein noncoding region, which of the following effects is most likely to happen?
a) no effect on final product
b) frameshift mutation
c) silent mutation
d) nonsense mutation
Which of the following is true of RNA processing?
a) Nucleotides are added at both ends of the RNA
b) RNA splicing adds a poly-A tail to the mRNA
c) Exons are cut out before mRNA leaves the nucleus
d) Ribozymes may function in the addition of a 5’ cap
e) Exons are cut out before mRNA leaves the nucleus
a) Nucleotides are added at both ends of the RNA
The template strand of a portion of a gene reads 3’-AACTGG-5’. What will be the sequence of a resulting transcript for this portion?
a) 3’-UUGACC-5’
b) 5’-TTGACC-3’
c) None of the listed choices is correct
d) 5’-UUGACC-3’
e) 3’-TTGACC-5’
5’-UUGACC-3’
DNA carries out two basic functions in cells: (1) information storage and transfer (genes can be copied and passed to offspring) and (2) the “blueprint” function (genes provide instructions for building proteins). The key process for information storage and transfer to offspring cells is _____.
a) DNA splicing
b) mRNA processing
c) translation
d) DNA replication
e) transcription
d) DNA replication
