WACEEEEEEEEEEEE Flashcards
describe sturcutre of codon
A series of three nucleotide bases in mRNA. E.g. ATT, GCT.
Each codon corresponds to an amino acid used in protein synthesis.
Suggest why the information contained within genes is referred to as the ‘universal genetic code’.
Almost every organism uses the four nitrogenous bases in DNA and RNA to translate genetic information into proteins.
The same codons code for the same amino acids in most organisms.
3’ CAATTGATAAGTCAGTCAATGGAT 5’
5’ GTTAACTATTCAGTCAGTTACCTA 3’
Determine the mRNA sequence that would be synthesised from the DNA strand shown above.
Must be a transcription of the template strand - 3’ to 5’.
Correct mRNA strand with uracil replacing thymine.
5’ GUU AAC UAU UCA GUC AGU UAC CUA 3’
Explain how having many more codes than amino acids could be of benefit to the process of protein synthesis.
If a mistake occurs there is a greater chance of translating for the same amino acid.
If this occurs, it will have no effect on the final protein or its function.
Define the term ‘speciation’
Evolutionary process whereby a population of a single species can evolve and change over time to form two (or more) distinct species.
Describe the four (4) main factors that influence the process of speciation.
1.Geographical Isolation.
A population or populations are physically separated and exposed to different selection pressures.
2. Gene flow reduction.
An isolated population cannot share/transfer genetic information, leading to genetic drift.
3. Hybridisation.
Mating between individuals of very similar species produces a third, hybrid species, different from either parent, that is usually infertile.
4. Reproductive isolation.
Gene pools are separated and prevented from mixing. This allows each population to evolve in isolation (due to genetic drift and alternate selection pressures).
Explain how microevolution differs from macroevolution.
Microevolution is the evolutionary change within a population due to changes in allele frequencies.
These changes are caused by mutations, gene flow, genetic drift and selection pressures.
Macroevolution describes evolutionary change above the species level.
Usually refers to speciation or adaptive radiation, when many new species evolve as a result of major environmental changes.
Explain why these genetically modified goats are considered ‘transgenic’ animals.
The goats carry ‘foreign’ DNA from another species that has been deliberately inserted into their genome.
This foreign DNA can enable the goats to synthesise a protein that it does not normally code for/make.
Identify four (4) main differences between mitosis and meiosis
Mitosis produces 2 x 2n daughter cells; meiosis produces 4 x n daughter cells.
Mitosis occurs in somatic cells; meiosis occurs in reproductive/sex cells.
Mitosis gives rise to cells that are genetically identical; meiosis gives rise to cells that are not identical to the parent or each other.
Mitosis has one ‘cycle’ (IPMAT) while meiosis has a second, slightly modified cycle (IPMATPMAT).
Mitosis does not have any extra processes to increase genetic variation; meiosis includes crossing over and independent assortment.
Mutations in mitosis are not passed onto offspring; mutation in meiosis are usually passed onto offspring.
Explain what is meant by ‘independent assortment of alleles’
Homologous chromosomes are replicated at the beginning of meiosis. Each homologue has a copy or sister chromatid.
Homologues line up in the centre of the cell separately. E.g. each copy of chromosome 15 with its sister chromatid are not joined to or located near one another.
When the cell undergoes the first cytokinesis, the homologous pairs are able to move independently of each other.
The homologous pairs and their alleles are able to move into separate cells (or sorted independently of each other).
restiction enzyme explanation
Restriction endonucleases or restriction enzymes.
These enzymes cleave the DNA at specific nucleotide sequences.
These sequences are known as restriction sites.
Explain the function of a DNA primer and their importance in the PCR process.
DNA primers are segments of single-stranded DNA, about 20 nucleotides long.
The primers bind to the end of the DNA strand being amplified, in the 3’ to 5’ direction.
DNA polymerase adds new nucleotides to form a new strand but can only do this from an existing nucleotide. The primer provides this nucleotide.
Explain the effect of ‘switching off’ the lactase (LCT) gene on cellular processes.
Gene will not be transcribed into mRNA.
No mRNA means that translation will not take place.
The protein/enzyme will not be synthesised (at ribosomes).
Suggest the most appropriate genetic test which could be used to discover if a person was carrying the lactase-persistent mutation. Explain your response.
DNA Microarray
Checks for genes that are ‘switched on’ by analysing presence of the corresponding mRNA. A person with the mutation will have mRNA.
Suggest why autosomal dominance has allowed for the perpetuation of the lactase-persistent trait in humans.
If an individual is homozygous, the dominant allele for the trait is always passed on to offspring.
If an individual is heterozygous, the dominant allele is passed on 50% of the time.
eukaryotes vs prokaryotes
Single-stranded DNA.
Double-stranded DNA in a double helix structure.
No nucleus present to contain DNA - free floating in cytosol.
Membrane-bound nucleus containing DNA.
Whole genome is found on one length of single-stranded DNA.
DNA is condensed into multiple chromosomes so more information can be carried.
May contain plasmids - small circular double-stranded DNA that can replicate independently.
No plasmids are present - all codes are found within chromosomes.
Suggest two characteristics of Taq Polymerase that explain its importance to the PCR technique
Will not denature when exposed to high temperatures required in PCR.
Functions most effectively at high temperatures (70oC) so replication is efficient and quick.
Explain two reasons for using mtDNA instead of nuclear DNA in this particular type of genetic analyses.
Less susceptible to mutations and recombination so there is variation between different species but not within species.
Many mitochondria in each cell so more mtDNA can be extracted.
Explain how the use of these restriction enzymes can produce the species-specific genetic ‘fingerprints’ from the gene fragments.
Restriction enzymes have specific base-pair sequences on the DNA to which they are complementary, called restriction sites.
Restriction sites are found at different positions on the DNA of different species.
When restriction enzymes cut the DNA, different length fragments are produced for each species.
When run through electrophoresis, the different sized fragments will show up in different positions in the gel, creating a ‘fingerprint’.
Identify the type of information that scientists can observe directly from fossils.
- Body morphology
- Diet of the organism (if animal).
- Conditions in which the organism lived or died.
- Climate
- Mode of locomotion of animal.
- Ancestry
Define the term ‘transitional fossil’. Use an example to explain how transitional fossils are important to our understanding of evolutionary change.
A transitional fossil is a term used to describe a fossil that shows a transitional form of two different species.
The transitional fossil will show a combination of traits from the species that preceded it and the species that followed it.
Transitional fossils are the preserved evidence of transitional forms of organisms - the ‘missing links’ which provide support to the theory of descent with modification.
* Pakicetus - whale and terrestrial mammal.
Explain the purpose of an index fossil in palaeontology.
Fossil remains of an organism that lived in a particular (narrow) geological time frame and is widely distributed.
Characteristic of particular geological formations so are used to determine the age of related formations.
Define ‘sexual selection’.
Inherited characteristics/traits in an organism,
that improve its chance of attracting a mate/breeding success.
Sexual selection is not considered an example of adaptive or natural selection. Explain why this is the case.
Sexual selection is determined by mating success due to favourable inherited characteristics.
Adaptive/natural selection is influenced by environmental pressures.
Environmental pressures do not influence the frequency of phenotypes associated with successful courtship.
Mate selection by female counterparts will determine the allelic frequency of sexual characteristics.
Identify two other evolutionary processes that are not influenced by natural selection.
Genetic drift
Founder effect
Identify two structures, common to each developing embryo, used in comparative embryology.
- Pharyngeal slits
- Tail
- Dorsal notochord
Homologous structure
Similar physical structures in different organisms, often with a different function.
Organisms with homologous structures share a recent common ancestor and evolved though divergent evolution.
Analogous structure (2 marks)
Similar structures in unrelated organisms that have the same function.
Organisms with analogous structures have no recent common ancestor and developed as a result of convergent evolution.
Identify and briefly outline the technique widely used to measure the genetic relatedness between different species.
Molecular/DNA hybridisation
Strands of DNA from related species are mixed together and heated, separating strands and exposing bases.
DNA strands from different species (are cooled and) recombine/hybridise by base-pair matching at genetically identical regions.
Level of hybridisation between different species’ DNA reveals how genetically similar/related they are to each other.
Explain why there is a lack of precision when measuring divergence patterns of evolution.
Speciation can occur over millions of years.
A precise time cannot be given to a gradual process.
Genotype
Specific combination of alleles at particular gene loci (for a trait) in an organism/cell.
Phenotype
Visible/expressed characteristic (based on the genotype).
Explain the difference between a gene and an allele.
A gene is a sequence of nucleotides coding for a trait/protein.
Alleles are variant forms of a gene (inherited from each parent).
Genome
All the genetic material contained in a cell (coding and non-coding).
Explain one (1) issue associated with growing crops with a high level of homozygosity.
Less/decreased genetic variation.
Reduces population ‘fitness’.
or
Population more susceptible to catastrophic events.
mutation effect
- DNA replication disrupted as normal base pairing cannot occur (producing mutated daughter cells).
- Transcription affected and mutated mRNA may be produced.
- Translation may not result in correct polypeptide/protein due to mutated mRNA.
- Production of faulty proteins/enzymes affects normal cell function.
Suggest two (2) reasons for inoculating 10 Petri dishes with the bacteria broth for each UV exposure time.
- Calculate the mean/average.
- Reduces effect of experimental error, increasing data validity.
- Reduces the effect of outliers on data.
- Increases the chance of representative sampling/reduces chance effects.
- More reliability in drawing conclusions.
State two (2) ways in which the students could improve the reliability of the investigation
- Tighter/closer time intervals for UV exposure.
- Longer incubation time for inoculated Petri dishes.
- Petri dishes treated for inhibition of other bacterial growth.
- Apply UV at different strengths (as kJ m-1).
- More petri dishes inoculated for each time trial.
- Different method of quantifying bacterial growth.
Explain two (2) ways the genetic diversity of a bacterial species can be increased.
Mutation
DNA mutation introduces new alleles into gene pool.
Conjugation
Process by which adjacent bacterial cells copy and share plasmid DNA.
Describe how scientists identify which bacterial cells contain recombined DNA
Antibiotic resistance gene also inserted into plasmid with foreign gene.
‘Recombinant’ bacterial cells are grown in medium containing antibiotic.
Cells that grow on medium contain recombined plasmid.
Explain how natural selection allowed for the evolution of these subspecies.
Genetic variation exists in gene pool.
Populations inhabiting different habitats have different selective pressures from the environment.
Individuals with phenotypes favoured in each habitat/population survive and reproduce more frequently.
Traits are passed onto successive generations.
Genotypic frequency changes over time leading to evolution of subspecies.
Suggest three (3) reasons why mtDNA was used in this investigation.
- Mutation rate high (greater than nuclear DNA).
- mtDNA inherited from maternal line only.
- mtDNA abundant in cells.
- No genetic recombination as only inherited from mother.
- Useful for comparing recent divergence (= or >20 million years).
Biogeography
Distribution of organisms over geographical areas.
Closely related species usually found in close geographical proximity.
or
Closely related species may be found in previously connected land masses.
Fossils found in these geographical areas resembling living species suggests common ancestry.
Define ‘short tandem repeat’.
Segment of non-coding DNA
with the same sequence of nucleotides repeated.
Explain why STRs are used in genetic profiling.
- Unique to each individual.
- Inherited from both parents.
- Many different STRs in genome.
- Useful for proving paternity/parentage.
Outline the basic principles behind the use of gel electrophoresis for DNA profiling
- DNA has an overall negative charge.
- DNA fragments are separated based on size/number of bases/molecular weight.
- Process uses an electric current passed from a positive to negative probe.
- DNA fragments placed in wells in the gel at negative probe end.
- Small fragments migrate further through the gel than large fragments.
- Migration of DNA fragments from each well creates a DNA ‘fingerprint’ or unique band pattern.
- Band patterns can be compared with other samples for similarities.
Discuss one (1) factor that should be considered prior to their release.
- Habitat size - is the natural habitat a suitable size to allow a sufficient population to grow or allow for territorial behaviours.
- Habitat fragmentation - is the natural habitat connected to adjacent areas via wildlife corridors to allow gene flow between populations.
- Existing natural population - is the population of existing animals large enough or genetically diverse enough to support conservation efforts.
Identify two (2) other applications of gel electrophoresis in biotechnology.
- Forensic testing (crime analysis).
- Genetic disease diagnosis.
- Phylogenetics - species comparison.
- Protein separation.
- Identification of unknown samples (e.g. illegal wildlife trade).
- Testing restriction enzymes.
- Conservation genetics.
Why is DNA replication important for survival
- All living organisms use DNA as their genetic material.
- DNA replication is crucial to production of new cells.
- Growth and repair cannot occur without DNA replication.
- Production of gametes for sexual reproduction requires replication of DNA.
State one change that could be made to the experimental design and explain how it improves the reliability of the data.
- increase the number of trials to eliminate anomalies
- repeat whole experiment for consistency
Define intron.
Intron: non-coding DNA
Describe the role of mRNA in protein synthesis.
- carries the DNA code
- from the nucleus to the ribosomes
- where codons are read
- so that tRNA can bring the correct amino acid for protein synthesis or so ribosomes can synthesis proteins (encoded for by DNA)
(c) Describe the biotechnological processes used to create Bt corn.
- Remove the gene, that codes for the toxin, from the donor DNA (from Bacillus thuringiensis)
- insert this gene into a Ti plasmid
- Ti plasmid taken up by bacteria
- Bacteria replicates creating many copies of the recombinant DNA/DNA containing the desired gene
- Bacteria containing the recombinant Ti plasmid inserts plasmid into corn plant cells/inserts the gene that codes for the toxin into the plants DNA
- Bt corn grown from modified cells (containing the gene that codes for the toxin)
(d) Explain why the Ti plasmid must be modified when used in plant biotechnology.
- The tumour inducing region of the plasmid will cause the host plant to produce tumours/galls.
- This is not beneficial to the host plant/This is detrimental to the host plant.
- There must be modified so that the host plant doesn’t form tumours.
effect of a point mutation
- one different amino acid in protein/gene product
- new DNA sequence and thus new allele
Describe the process of binary fission.
Only one chromosome/DNA is circular
DNA/Chromosome is duplicated (do not accept chromosomes)
Duplicated chromosomes move to the opposite ends of the cell
Cell elongates
Each copy of the duplicated chromosome attaches to a different part of the cell membrane
New cell wall is laid down
Cytoplasm splits also
Cell divides into two daughter cells
Each daughter cell has a copy of chromosome/DNA
Daughter cells/DNA is a clone of the original cell
Explain the role of fertilisation in the reproduction of snakes and other sexually reproducing animals.
- Fusion of gametes/haploid cells
- To create a diploid cell
- Combines genetic material from two different parents/individuals
- Meiosis produces haploid cells/gametes
- Results in genetic variation
(a) Describe the characteristics of a viable gene pool.
- size of population cannot be too low so unrelated organisms breed or high enough numbers to prevent inbreeding
- high genetic diversity/variation
- individuals must be able to successfully reproduce
- some juveniles must survive to reproduce
- able to withstand environmental adversity
(b) State why captive populations, bred for conservation, must have a viable gene pool?
So that genetic diversity is not lost/is maximised
(e) Define the term the comparative genomics.
the genome of two organisms are compared to each other
(a) Define the term allele frequency.
How many times an allele at a particular gene/locus appears in a population,
(f) Describe how genetic drift would affect a natural population of fruit flies.
- changes allele frequencies
- changes are random or occur by chance
- (causes) loss of diversity/alleles from a population
- (causes) differences between populations
(g) Explain how gene flow can change the allele frequencies in the gene pools of the fruit fly populations.
- allele frequencies of fruit fly populations may be different from each other
- (fruit flies migrating to new populations) must breed with the new population/ add their genes to the gene pool (of the destination population)
- (this will) alter the allele frequency of the (destination) population
- fruit flies (migrating) may have different alleles to the fruit flies in the destination population
- thus they may introduce new alleles to the (destination) population
- (due to gene flow) the allele frequencies of the fruit fly populations become more similar
(i) Explain the concept of selection.
- organisms with particular genotypes
- preferentially survive
- and reproduce to pass on the particular genotype
why does this improve reliablity
- increased amount of data/evidence to support the conclusion
- increases chances of representative sampling
- reduces the influence of outliers
(e) State one similarity and one difference in the role of ligases in DNA replication and protein synthesis. (2 marks)
Difference
* joins RNA nucleotides in protein synthesis and joins DNA nucleotides in DNA replication
OR
* joins amino acids in protein synthesis and joins DNA nucleotides in DNA replication
Any one of:
Similarity
* form chemical bonds/phosphodiester bonds between nucleotides
* joins monomers into polymers
(f) Explain how organisms having the same basic DNA, suggests that there is a common origin for all life on earth.
- all organisms have DNA with the same basic structure
- DNA codes for the same (20) amino acids across all organisms
- DNA is passed onto offspring (over generations and time) therefore all organisms have a common origin (as they have the same basic DNA structure)
(g) Explain how comparing DNA between species is evidence for the theory of evolution.
- DNA is used in protein synthesis/DNA has the same process for gene expression
- the DNA codes for the same (20) amino acids across organisms
- comparing DNA sequences/proteins for the same gene in different species
- the more similar the DNA sequence /amino acid sequence in a protein
- the more closely related the organism/species are
- the more recent the common ancestor
(a) Define the term ‘recombinant DNA’.
- DNA from two species that are combined and placed/in an organism
(b) Explain a possible adverse effect, that the farmer may encounter, when growing a ‘GTC’ crop.
- These plants could pollinate to other parts of the farm/non GM crops/ other plants
- herbicide resistant weeds/plants cannot be killed using glyphosate
(c) Explain possible adverse effects on non-target species when ‘GTC’ crop is grown.
- Leading to evolution of glyphosate herbicide resistant weeds/ non-target species
- Potential for the glyphosate herbicide resistance gene to spread to other species.
- Create a superweeds that are resistant to glyphosate herbicides
