WACEEEEEEEEEEEE Flashcards
describe sturcutre of codon
A series of three nucleotide bases in mRNA. E.g. ATT, GCT.
Each codon corresponds to an amino acid used in protein synthesis.
Suggest why the information contained within genes is referred to as the ‘universal genetic code’.
Almost every organism uses the four nitrogenous bases in DNA and RNA to translate genetic information into proteins.
The same codons code for the same amino acids in most organisms.
3’ CAATTGATAAGTCAGTCAATGGAT 5’
5’ GTTAACTATTCAGTCAGTTACCTA 3’
Determine the mRNA sequence that would be synthesised from the DNA strand shown above.
Must be a transcription of the template strand - 3’ to 5’.
Correct mRNA strand with uracil replacing thymine.
5’ GUU AAC UAU UCA GUC AGU UAC CUA 3’
Explain how having many more codes than amino acids could be of benefit to the process of protein synthesis.
If a mistake occurs there is a greater chance of translating for the same amino acid.
If this occurs, it will have no effect on the final protein or its function.
Define the term ‘speciation’
Evolutionary process whereby a population of a single species can evolve and change over time to form two (or more) distinct species.
Describe the four (4) main factors that influence the process of speciation.
1.Geographical Isolation.
A population or populations are physically separated and exposed to different selection pressures.
2. Gene flow reduction.
An isolated population cannot share/transfer genetic information, leading to genetic drift.
3. Hybridisation.
Mating between individuals of very similar species produces a third, hybrid species, different from either parent, that is usually infertile.
4. Reproductive isolation.
Gene pools are separated and prevented from mixing. This allows each population to evolve in isolation (due to genetic drift and alternate selection pressures).
Explain how microevolution differs from macroevolution.
Microevolution is the evolutionary change within a population due to changes in allele frequencies.
These changes are caused by mutations, gene flow, genetic drift and selection pressures.
Macroevolution describes evolutionary change above the species level.
Usually refers to speciation or adaptive radiation, when many new species evolve as a result of major environmental changes.
Explain why these genetically modified goats are considered ‘transgenic’ animals.
The goats carry ‘foreign’ DNA from another species that has been deliberately inserted into their genome.
This foreign DNA can enable the goats to synthesise a protein that it does not normally code for/make.
Identify four (4) main differences between mitosis and meiosis
Mitosis produces 2 x 2n daughter cells; meiosis produces 4 x n daughter cells.
Mitosis occurs in somatic cells; meiosis occurs in reproductive/sex cells.
Mitosis gives rise to cells that are genetically identical; meiosis gives rise to cells that are not identical to the parent or each other.
Mitosis has one ‘cycle’ (IPMAT) while meiosis has a second, slightly modified cycle (IPMATPMAT).
Mitosis does not have any extra processes to increase genetic variation; meiosis includes crossing over and independent assortment.
Mutations in mitosis are not passed onto offspring; mutation in meiosis are usually passed onto offspring.
Explain what is meant by ‘independent assortment of alleles’
Homologous chromosomes are replicated at the beginning of meiosis. Each homologue has a copy or sister chromatid.
Homologues line up in the centre of the cell separately. E.g. each copy of chromosome 15 with its sister chromatid are not joined to or located near one another.
When the cell undergoes the first cytokinesis, the homologous pairs are able to move independently of each other.
The homologous pairs and their alleles are able to move into separate cells (or sorted independently of each other).
restiction enzyme explanation
Restriction endonucleases or restriction enzymes.
These enzymes cleave the DNA at specific nucleotide sequences.
These sequences are known as restriction sites.
Explain the function of a DNA primer and their importance in the PCR process.
DNA primers are segments of single-stranded DNA, about 20 nucleotides long.
The primers bind to the end of the DNA strand being amplified, in the 3’ to 5’ direction.
DNA polymerase adds new nucleotides to form a new strand but can only do this from an existing nucleotide. The primer provides this nucleotide.
Explain the effect of ‘switching off’ the lactase (LCT) gene on cellular processes.
Gene will not be transcribed into mRNA.
No mRNA means that translation will not take place.
The protein/enzyme will not be synthesised (at ribosomes).
Suggest the most appropriate genetic test which could be used to discover if a person was carrying the lactase-persistent mutation. Explain your response.
DNA Microarray
Checks for genes that are ‘switched on’ by analysing presence of the corresponding mRNA. A person with the mutation will have mRNA.
Suggest why autosomal dominance has allowed for the perpetuation of the lactase-persistent trait in humans.
If an individual is homozygous, the dominant allele for the trait is always passed on to offspring.
If an individual is heterozygous, the dominant allele is passed on 50% of the time.
eukaryotes vs prokaryotes
Single-stranded DNA.
Double-stranded DNA in a double helix structure.
No nucleus present to contain DNA - free floating in cytosol.
Membrane-bound nucleus containing DNA.
Whole genome is found on one length of single-stranded DNA.
DNA is condensed into multiple chromosomes so more information can be carried.
May contain plasmids - small circular double-stranded DNA that can replicate independently.
No plasmids are present - all codes are found within chromosomes.
Suggest two characteristics of Taq Polymerase that explain its importance to the PCR technique
Will not denature when exposed to high temperatures required in PCR.
Functions most effectively at high temperatures (70oC) so replication is efficient and quick.
Explain two reasons for using mtDNA instead of nuclear DNA in this particular type of genetic analyses.
Less susceptible to mutations and recombination so there is variation between different species but not within species.
Many mitochondria in each cell so more mtDNA can be extracted.
Explain how the use of these restriction enzymes can produce the species-specific genetic ‘fingerprints’ from the gene fragments.
Restriction enzymes have specific base-pair sequences on the DNA to which they are complementary, called restriction sites.
Restriction sites are found at different positions on the DNA of different species.
When restriction enzymes cut the DNA, different length fragments are produced for each species.
When run through electrophoresis, the different sized fragments will show up in different positions in the gel, creating a ‘fingerprint’.
Identify the type of information that scientists can observe directly from fossils.
- Body morphology
- Diet of the organism (if animal).
- Conditions in which the organism lived or died.
- Climate
- Mode of locomotion of animal.
- Ancestry
Define the term ‘transitional fossil’. Use an example to explain how transitional fossils are important to our understanding of evolutionary change.
A transitional fossil is a term used to describe a fossil that shows a transitional form of two different species.
The transitional fossil will show a combination of traits from the species that preceded it and the species that followed it.
Transitional fossils are the preserved evidence of transitional forms of organisms - the ‘missing links’ which provide support to the theory of descent with modification.
* Pakicetus - whale and terrestrial mammal.
Explain the purpose of an index fossil in palaeontology.
Fossil remains of an organism that lived in a particular (narrow) geological time frame and is widely distributed.
Characteristic of particular geological formations so are used to determine the age of related formations.
Define ‘sexual selection’.
Inherited characteristics/traits in an organism,
that improve its chance of attracting a mate/breeding success.
Sexual selection is not considered an example of adaptive or natural selection. Explain why this is the case.
Sexual selection is determined by mating success due to favourable inherited characteristics.
Adaptive/natural selection is influenced by environmental pressures.
Environmental pressures do not influence the frequency of phenotypes associated with successful courtship.
Mate selection by female counterparts will determine the allelic frequency of sexual characteristics.
