Unit 4: Cells Flashcards
Organelle function: Cell membrane/plasma membrane
Surrounds the cell; Keeps stuff in and out
Organelle function: Cytoplasm
Internal cell fluid which holds all other structures inside the cell
What are cell membranes composed of?
Phospholipids
What are phospholipids comprised of?
Hydrophilic head: Glycerol + Phosphate
Hydrophobic tails: 2 fatty acids (one saturated, one unsaturated)
What’s the polarity of the phosphate head?
Polar covalent bonds.
Hydrophilic
What’s the polarity of the fatty acid tails?
Nonpolar
Hydrophobic
What’s the organization of the phospholipid bilayer?
Head – Tails – Tails – Head
Do phospholipids interact with one another in the bilayer?
There are no chemical bonds between individual phospholipids.
A very flexible and fluid mosaic
Allows for movement of membrane and proteins embedded in the membrane
In what way does the cell membrane allow transport?
Selective permeability
The hydrophobic interior (brought to us by the hydrophobic fatty tails) prevents the transport of most molecules
It allows lipids and other small nonpolar molecules (such as O2) and very small polar molecules (such as H2O)
What are the two structure types of proteins that are contained in the cell membrane?
Integral and Peripheral
Integral proteins stick out on either end (span the entire membrane)
Peripheral proteins just stick out on one end
What’s the function of this protein: Receptors
Outside substances bind to them
What’s the function of this protein: Enzymes
Speed up the chemical reactions on the inside of outside of the cell
What’s the function of this protein: Aquaporins
Move water inside or outside the cell
What’s the function of this protein: Channels
Move other substances inside or outside the cell
What is cytoplasm comprised of?
Cytosol: water, ions, enzymes
Organelles
Organelle function: Nucleus
Holds the DNA
Houses the nucleolus
Bound by a double membrane nuclear envelope
Has nuclear pores to allow transport of particular molecules in/out
What is the nucleolus?
Where ribosomes are made and RNA is transcribed
What is chromatin?
A complex of DNA and proteins that forms the chromosomes within the nucleus
Exists in two forms: Euchromatin (less condensed) and Heterochromatin (condensed)
What are ribosomes?
Made of RNA and protein- rRNA
Make proteins using the info from RNA
Organelle function: Mitochondria
Contains its own DNA and ribosomes
Site of cellular respiration
What is cellular respiration?
The process of breaking glucose down to get energy
Organelle function: Peroxisomes
Breaks down toxic molecules
Organelle function: Vesicles
How proteins and other chemicals move around a cell
A membrane bubble
Travels using the endomembrane system:
- Smooth/rough ER
-Golgi apparatus
Organelle function: Smooth Endoplasmic reticulum (ER)
Houses enzymes to break down drugs and poisons; synthesizes lipids
Further away from the “maze”
Organelle function: Rough Endoplasmic reticulum (ER)
Helps with protein synthesis, folding, and sorting
Has ribosomes on its surface (making it appear “rough”)
Organelle function: Golgi apparatus
Assists with protein folding and modification
Repackages proteins into vesicles and sends them towards the cell membrane
What are lysosomes?
The digestive system of the cell, breaks down molecules for parts
Cytoskeleton composition from smallest to largest:
Microfilaments –> Intermediate filaments –> microtubules
These are all involved in cell structure and molecule movement within the cell
Microtubules?
Used as a scaffolding during cell growth/division
Microfilaments?
Strengthen and change the shape of a cell
Intermediate filaments?
Main framework of cells
What organelles organize the microtubules?
Centrosomes made up of 2 centrioles
Which cellular extensions are on the inside versus outside of the cell?
Microvilli, cilia, flagella
Microvilli are finger-like projections on the inside of the cell membrane to increase surface area
Cilia and flagella are on the outside of the cell
What are cilia?
Short and fringe-like
Has coordinated movements like a wave to move particles in a certain direction
What’s an example of cilia?
Cells lining the trachea
What are flagella?
Longer structures that exist by themselves or in pairs
Function like a propeller
What’s an example of a flagella?
Sperm cells
What is the break down of a 1% NaCl solution? (What is its concentration?)
1 molecule of NaCl for every 99 water molecules
When there’s a concentration gradient…
There’s a different concentration of molecules on one side of a membrane
Define: Hypertonic, Isotonic, Hypotonic
Hypertonic: a solution with higher solute concentration
Isotonic: a solution with equal solute concentration
Hypotonic: a solution with less solute concentration
When do molecules NOT move from an area of high concentration to low concentration?
If a barrier is present restricting movement
Diffusion is…
Molecules moving down a gradient from high concentration to low concentration
More molecules will get bumped out than those that get bumped in
Solution A is 30% sugar- is the solution hypothonic/hyper/iso/none?
None! We have to compare it to another solution
Solution A is 30% sugar, solution B is 10% sugar…
Solution A is hypertonic to solution B
Inside the cell is 98% water, outside the cell is 70% water
The cell is hypertonic to surroundings
When molecules don’t require energy for assistance when passing through a membrane….
Passive transport
When molecules require some energy for assistance when moving through a membrane…
Active transport
Passive transport is always from ___ to ___
High to low concentration
What is simple diffusion?
Movement of small nonpolar molecules freely through the membrane (passively transported)
Ex. O2, CO2
What is facilitated diffusion?
Movement of polar molecules with the assistance of a protein
Ex. glucose
It’s still a passive transport as the solute is moving down the concentration gradient
What is osmosis?
Movement of water (even though its polar) across a membrane (passive transport)
Active transport is always from ___ to ___
Low to high concentration
What is primary active transport?
A form of active transport where ATP molecules are required to move from a low to high gradient (“against the gradient” NOT with)
Uses chemical energy
What is an example of primary active transport?
The sodium-potassium pump, where sodium ions are moved to the outside of the cell and potassium ions are moved to the inside of the cell
What is secondary active transport?
A form of active transport where one molecule is required to move down its gradient to allow/power a different molecule to move up the gradient
Example of secondary active transport?
The sodium-glucose pump, where cotransport by active sodium enzymes facilitate glucose moving upstream (2 sodiums for 1 glucose)
What is vesicular transport?
Active transport of large molecules too big to pass through a cell membrane or transport protein. It requires the use of vesicles
What is exocytosis?
Movement of molecules out of a cell (export)
What is endocytosis? What are its subcategories?
Movement of molecules into a cell (import).
Phagocytosis (large molecules)
Pinocytosis (large volumes of extracellular fluid)
What is transcytosis?
A combination of endocytosis and exocytosis to move a molecule through a cell
What are the 5 nitrogenous bases found in nucleotides?
Adenine, Thymine
Cytosine, Guanine, Uracil
Which nitrogenous bases are pyrimidines?
Which are purines?
Pyrimidines: C, T, and U
Purines: A, G
The complementary nitrogenous bases form what kind of bonds?
Hydrogen bonds
A-T
G-C
DNA copying is called…
Replication
Before DNA replication, chromosomes are made of one piece of double stranded SNA. After replication, replicated chromosomes are made of two pieces of identical double-stranded DNA called…
Sister chromatids
Both replicated and unreplicated chromosomes count as ___ chromosome
One
In RNA, what nitrogenous base is changed to uracil?
Thymine is changed to Uracil
How do the functions of DNA and RNA differ?
DNA stores information
RNA uses information (to make proteins, catalyze reactions, etc.)
What are the three major types of RNA?
Messenger (mRNA): Encodes proteins
Transfer (tRNA): Assists in protein synthesis (translation)
Ribosomal (rRNA): Builds ribosomes
Fill in the blanks:
DNA –> RNA –> Protein
_____ ______ ______
Replication, Transcription, Translation
DNA Replication vs Transcription:
Final molecules?
DNA Replication: 2 identical DNA molecules
Transcription: 1 RNA molecule that is not identical to the original DNA molecule
DNA Replication vs Transcription:
Nucleotides used?
DNA Replication: A-T, G-C
Transcription: A-U, G-C
DNA Replication vs Transcription:
Number of DNA strands copied?
DNA Replication: 2
Transcription: 1
DNA Replication vs Transcription:
Enzyme used?
DNA Replication: DNA polymerase
Transcription: RNA polymerase
DNA Replication vs Transcription:
Region copied?
DNA Replication: the whole DNA molecule
Transcription: a small segment; one gene
Where does transcription take place?
DNA –> RNA takes place in the nucleus
What are the steps in transcription?
- Initiation
- Elongation
- Termination
What is the initiation stage?
RNA polymerase binds to the promoter (the DNA sequence indicating the start of a gene)
What is the elongation stage?
The DNA double helix opens at a promoter
RNA polymerase builds an RNA strand complementary to one strand of DNA (pairing A with U not T)
What is translation?
RNA is used to make a protein via the ribosomes in the cytoplasm/on the rough ER
The ribosomes read the mRNA sequence, and corresponding amino acids are bonded together to make the protein
What is the termination stage?
RNA is released from DNA at the terminator sequence, the DNA goes back together
The RNA is now ready to make a protein
How many kinds of amino acids are there?
20
How many nucleotides make one amino acid? What are they called?
3; a codon
Which RNA reads mRNA and brings the correct amino acid in translation?
Transfer RNA (tRNA)
It has 2 attachment sites: one for the amino acid, and one where it attaches to the mRNA inside the ribosome (Anticodon)
Where do the amino acids come from to make proteins?
From the cytoplasm, either from nutrients or they are made in the cell
What is the translation start codon?
Met
What kind of bond forms between the starting codon and the following amino acid?
Peptide bond
What happens when a ribosome reaches a stop codon?
mRNA and amino acid chain are released
The ribosomal subunits seperate
Can mRNA be translated by multiple ribosomes simultaneously?
Yes! the mRNA is broken down more quickly afterwards
If more protein is needed, the DNA sequence will need to be transcribed again
Transcribe the DNA sequence to RNA, then the RNA to an amino acid sequence:
3’ - ATA CAC GTC TAG CAG - 5’
5’ - UAU GUG CAG AUC GUC- 3’
Tyr Val Gln Ile Val
RNA builds from the 5’ to 3’ direction, adding each new nucleotide to the 3’ end of the strand
What is the purpose of mitosis?
Cell division for growth and development
What is the purpose of meiosis?
Cell division for sex cell/gamete production and ultimately making new organisms
What is interphase?
Where a typical cell spends most of its life. It isn’t replicating, it’s just obtaining nutrients, metabolizing, growing, and preparing itself for mitosis
What happens in G1?
Normal cell business and protein synthesis
What happens in the S phase?
DNA replication, DNA repairs, protein synthesis, and duplication of the centrosome
What is the centrosome?
Organelles that serve as the main microtubule organizing structure; Regulator of cell division
What happens in G2?
Preparation for mitosis
Protein synthesis
What are homologous chromosomes?
Homologous pairs have the same length, shape, and genes (though they CAN have different alleles!)
These can be replicated or unreplicated
Before DNA replication, there are ___ chromosomes with __ chromatid per chromosome
Before DNA replication, there are unreplicated chromosomes with 1 chromatid per chromosome
After DNA replication, there are ___ chromosomes with __ chromatids per chromosome
After DNA replication, there are replicated chromosomes with 2 chromatids per chromosome
The centromere is where these sister chromatids attach
When do the sister chromatids split apart?
During mitosis, one unreplicated chromosome goes to each new cell
What is the first phase in mitosis?
Prophase
This is when DNA condenses and forms visible chromosomes
The centrosomes move to opposite poles where the microtubules organize and forms the mitotic spindle
When does the nuclear envelope break down and spindle fibers attach to centromeres?
Prophase
What happens during metaphase?
Chromosomes line up in the center of the cell at the metaphase plate
In what phase do chromatids separate from one another and go to opposite poles, and what are these now called?
Anaphase
The separated chromatids are now unreplicated chromosomes
What happens during telophase?
DNA decondenses (loosens up), the nuclear envelope reforms, spindle fibers break down, and cytokinesis occurs
Is cytokinesis a phase?
Nope! It is part of telophase.
This describes the physical splitting of the cell where organelles and cytoplasm are split evenly.
What happens during cytokinesis for specifically animal cells?
A cleavage furrow is formed, where the cell divides from the outside in
Which organelle breaks down toxins?
Peroxisomes
Lysosomes are for breaking down useful items for recycling (NOT harmful things)
What’s the difference between primary active transport and facilitated diffusion?
Primary active transport is moving a substance from an area of lower to higher concentration, using ATP
Facilitated diffusion is moving a substance from an area of higher to lower concentration through a protein
Given the following sequence of DNA, select the amino acid sequence it encodes:
AGCTACAGCTAGCGAATTGTA
Met-Ser-Ile-Ala
What happens first in transcription?
Two DNA strands separate
RNA polymerase attaches to the promoter sequence
DNA strands separate before the RNA polymerase attaches to the promoter sequence
