Triple Repeats Expansion Disorders: Lect 22

Question 1

Triple repeats:

Answer 1

• short tandem trinucleotide repeats. ex: ACGTTACTCAGCAGCAGTTGG
• 3x may grow or shrink
• TNR result from 3X beyond nl threshold.

Question 2

Mechanism for 3X Instability: Slippage

Answer 2

• Backward slippage: insertion mutation = expansion (repeat added to 1 daughter strand).
• Forward slippage: deletion mutation; shrinkage (loop found on template strand =1 daughter strand w/ few nt).

Question 3

Mechanism for 3X Instability: Unequal crossing over

Answer 3

-one chromatid doesn’t line up exactly resulting in 2 germ cells: one w/ a shortened repetitive region and another w/ an expanded repetitive region.

Question 4

Common Features of TNR:

Answer 4

• shows instability; repeats expanding in germ line
• may occur in exons, introns, UTR or non-RNA coding regions.
• show a decr. age of onset w/ increase in subsequent generation = Anticipation
• parental origin can influence anticipation.

Question 5

Mechanism for 3X disease:

Answer 5

• depends on where repeat is located.
  
  • protein coding region (gain of function or toxic protein)
  • RNA coding regions”introns/UTRs” (mRNA instability and translation effects)
  • Non-coding regions (transcriptional effects and interferes w/ regulation of nearby genes).

Question 6

Expansions in and around genes cause:

Answer 6

• CGG = Fragile X synd. repeat in 5’ UTR, leads to methylation/epigenetic silencing = LoF
• GAA = Friedreich ataxia. Intronic repeat leads to formation of heterochromatin = LoF.
• CAG = Huntington/Spinocerebellar ataxia. Polyglutamine repeat in protein coding region. Huntington = GoF
• CTG = Myotonic dystrophy. 3’ UTR repeat which leads to changes in RNA processing. GoF.

Question 7

Huntington’s Disease:

Answer 7

• AD(determined by positional cloning methods),
• polyglutamine disease
• neurodegenerative; progressive dementia and invol movements
• no cure/treatment
• degeneration of neurons in BG(chorea) and cerebral cortex.
• paternal anticipation (expansion during male gametogenesis)
• avg age of onset = 40yrs old

Question 8

Selective advantage:

Answer 8

-germ cells or gametes that contain an expanded repeats.

Question 9

Molecular mechanism of HD:

Answer 9

• expansion of CAG repeat (40 to>100)
• incr in polyglutamine tract length causes the Huntington protein to aggregate, form inclusion bodies and act as a toxin.
• Abnl Huntington protein interact w/ a number of TFs causing dysregulation of gene expression.

Question 10

Fragile-X

Answer 10

• Martin-Bell syndrome, X-linked dominant.
• Maternal anticipation
• most common inherited form of intellectual disability.
• intellectual disability, cluttered and nervous speech, elongated face/prominent ears, low muscle tone and flat feet, macroorchidism.
• expansion of CGG in 5’UTR of FMR1 gene causing fragile site seen via Karyotype analysis.
• 5-20 = nl, 50-200 = premutation, >200 = mutation
• males more severely affected.

Question 11

Myotonic Dystrophy:

2 types

Answer 11

• AD; maternal anticipation in congenital form
• highest triplet expansion.
• CTG repeat in 3’UTR of DMPK gene on chrom19.
• loss/misregulation of RNA binding proteins appears to cause altered cell function (splicing)
• slow muscle relaxation after contraction
• multi-systemic disease; no cure/treatment
• weakness in distal muscle, cataracts, endocrine changes(insulin resistance)

DM1 (most common)
-myotonia & weakness in distal muscle, cognitive probs, weakness in face and jaw, drooping eyelids.

DM2
-muscle pain/stiffness, fatigue, weakness in prox. lower extremities

Question 12

Friedreich Ataxia:

Answer 12

• AR; onset btwn 5-15 yrs, late onset 20-35 yrs.
• inherited from both parents.
• 1st sx: difficulty walking & loss of tendon reflexes in ankles/knees.
• lack of muscle coordination during vol. movements
• progressive neurodegenerative disease.
• ataxia and muscle weakness, vision and hearing impairment, scoliosis, diabetes, heart disorders.
• Paternal anticipation
• GAA repeat (200->900) in intron 1 of frataxin gene chrom9.
• repeat alters chromatin structure = heterochromatin.

Question 13

Spinocerebellar ataxia

Answer 13

• AD, AR, XL
• paternal anticipation “CAG”
• muscle degenerative disease
• lack of coordination of hands, eyes and speech
• locus heterogeneity
• mostly caused by CAG repeat in exons of 29 diff genes “polyglutamine disorder” = protein aggregation and cytotoxic protein.
• Spinocerebellar ataxia 8 = caused by CTG repeat in 3’ terminal exon of non-coding RNA from SCA8gene; alters protein binding to RNA.