Science Midterm

Question 1

boosts the immune system

Answer 1

Vaccine

Question 1

kills bacteria

Answer 1

Anti-biotic

Question 1

decreases the viral count

Answer 1

Anti-viral

Question 2

decreases coughing

Answer 2

Anti-tussive

Question 3

decreases swelling

Answer 3

Anti-inflammatory

Question 4

breaks down dead or decaying matter

Answer 4

Decomposers

Question 5

encapsulated the viral nucleic acid

Answer 5

Viral protein coat

Question 6

a membrane surrounds the organelle (like the nucleus, mitochondria, or chloroplasts

Answer 6

Membrane-bound organelles

Question 7

have a nucleus and membrane-bound organelles

Answer 7

Eukaryotes

Question 8

no nucleus or membrane-bound organelles

Answer 8

Prokaryotes

Question 9

used for cell motility (movement)

Answer 9

Flagellum

Question 10

the doubling of DNA in preparation for cellular division

Answer 10

DNA synthesis

Question 11

from DNA to RNA

Answer 11

DNA transcription

Question 12

from RNA to protein

Answer 12

RNA translation

Question 13

1 gene creates one polypeptide; transcription and translation; information flows from the DNA to RNA to protein, not in reverse

Answer 13

Central Dogma

Question 14

made up of a base, sugar, and phosphate; monomer for nucleic acids

Answer 14

Nucleotide

Question 15

the second strand of DNA

Answer 15

Complementary Strand

Question 16

monomer of proteins

Answer 16

Amino acid

Question 17

point mutation where a nucleotide is inserted and a frameshift results

Answer 17

Insertion

Question 18

point mutation where a nucleotide is deleted and a frameshift results

Answer 18

Deletion

Question 19

point mutation where one nucleotide is changed for another; no frameshift

Answer 19

Substitution

Question 20

viral replication where the host cell is killed to make many viruses

Answer 20

Lytic cycle

Question 21

viral replication where the viral nucleic acid hides in the host cell

Answer 21

Lysogenic Cycle

Question 22

the process of bacterial reproduction where one cell splits into two identical cells

Answer 22

Binary fusion

Question 23

What is the #1 role of bacteria in our ecosystem?

Answer 23

Decomposers

Question 24

What are the components of a typical virus?

Answer 24

Protein coat and nucleic acids

Question 25

What are the components of a typical bacterium?

Answer 25

Cell membrane, DNA, and ribosomes

Question 26

Explain the 2 ways viruses can replicate.

Answer 26

Lytic where the host cell is killed and lysogenic where the virus hides in the host cell.

Question 27

How do bacteria move?

Answer 27

Flagella

Question 28

Explain the shape of the following: DNA, RNA, protein

Answer 28

DNA- double stranded RNA- single stranded Protein- globular, beads on a necklace

Question 29

What different molecules does DNA synthesis (replication) create?

Answer 29

DNA synthesis doubles the DNA. Each original strand gets a new strand. Therefore 2 new and 2 old. Old pairs with new.

Question 30

What are the three parts of the nucleotide?

Answer 30

Nitrogen base, sugar and phosphate

Question 31

What are the levels of organization starting with the smallest to the largest from a gene and to the cell?

Answer 31

gene, DNA, chromosome, nucleus, cell

Question 32

Where does DNA replication (synthesis) take place?

Answer 32

Nucleus

Question 33

Where does transcription take place?

Answer 33

Nucleus

Question 34

Where does translation take place?

Answer 34

Cytoplasm

Question 35

List 4 differences between DNA and RNA.

Answer 35

1. DNA is double-stranded, and RNA is single-stranded 2. DNA uses CATG and RNA uses GUAC 3. DNA is in the nucleus while RNA can travel outside the nucleus 4. DNA has deoxyribose while RNA has ribose

Question 36

How many nucleotides code for a codon?

Answer 36

3

Question 37

Where are proteins made?

Answer 37

Ribosomes in the cytoplasm

Question 38

4 haploid daughter cells are produced by division of the cytoplasm.

Answer 38

Cytokinesis 2

Question 39

Homologous chromosomes condense and cross over.

Answer 39

Prophase 1

Question 40

DNA is synthesized (replicated).

Answer 40

Interphase

Question 41

Sister chromatids separate away from the center to opposite poles.

Answer 41

Anaphase 2

Question 42

Sister chromatids condense and become visible.

Answer 42

Prophase 2

Question 43

Homologous chromosomes line up in the middle of the cell.

Answer 43

Metaphase 1

Question 44

The cytoplasm splits producing 2 haploid daughter cells.

Answer 44

Cytokinesis 1

Question 45

Homologous chromosomes are pulled away from the center of the cell to the opposite poles.

Answer 45

Anaphase 1

Question 46

The nuclear membrane reforms around 2 haploid nuclei but 2 daughter cells have not been formed by cytokinesis yet.

Answer 46

Telophase 1

Question 47

Sister chromatids line up at the middle of the cell.

Answer 47

Metaphase 2

Question 48

The nuclear membrane reforms in 2 daughter cells resulting in 4 haploid nuclei, but cytokinesis has not occurred yet.

Answer 48

Telophase 2

Question 49

This is a strand of DNA that needs to be synthesized (replicated). Insert the appropriate bases: ATCGTTACTGCAACACCCTTACTAAA

Answer 49

TAGCAATGACGTTGTGGGAATGATTT

Question 50

This is the same strand that needs to be transcribed into RNA using base pair rules: ATCGTTACTGCAACACCCTTACTAAA

Answer 50

UAGCAAUG-ACG-UUG-UGG-GAA-UGA-UUU

Question 51

is making a protein from a gene. It involves transcription and translation.

Answer 51

Gene Expression