Science Midterm Flashcards
boosts the immune system
Vaccine
kills bacteria
Anti-biotic
decreases the viral count
Anti-viral
decreases coughing
Anti-tussive
decreases swelling
Anti-inflammatory
breaks down dead or decaying matter
Decomposers
encapsulated the viral nucleic acid
Viral protein coat
a membrane surrounds the organelle (like the nucleus, mitochondria, or chloroplasts
Membrane-bound organelles
have a nucleus and membrane-bound organelles
Eukaryotes
no nucleus or membrane-bound organelles
Prokaryotes
used for cell motility (movement)
Flagellum
the doubling of DNA in preparation for cellular division
DNA synthesis
from DNA to RNA
DNA transcription
from RNA to protein
RNA translation
1 gene creates one polypeptide; transcription and translation; information flows from the DNA to RNA to protein, not in reverse
Central Dogma
made up of a base, sugar, and phosphate; monomer for nucleic acids
Nucleotide
the second strand of DNA
Complementary Strand
monomer of proteins
Amino acid
point mutation where a nucleotide is inserted and a frameshift results
Insertion
point mutation where a nucleotide is deleted and a frameshift results
Deletion
point mutation where one nucleotide is changed for another; no frameshift
Substitution
viral replication where the host cell is killed to make many viruses
Lytic cycle
viral replication where the viral nucleic acid hides in the host cell
Lysogenic Cycle
the process of bacterial reproduction where one cell splits into two identical cells
Binary fusion
What is the #1 role of bacteria in our ecosystem?
Decomposers
What are the components of a typical virus?
Protein coat and nucleic acids
What are the components of a typical bacterium?
Cell membrane, DNA, and ribosomes
Explain the 2 ways viruses can replicate.
Lytic where the host cell is killed and lysogenic where the virus hides in the host cell.
How do bacteria move?
Flagella
Explain the shape of the following: DNA, RNA, protein
DNA- double stranded
RNA- single stranded
Protein- globular, beads on a necklace
What different molecules does DNA synthesis (replication) create?
DNA synthesis doubles the DNA. Each original strand gets a new strand. Therefore 2 new and 2 old. Old pairs with new.
What are the three parts of the nucleotide?
Nitrogen base, sugar and phosphate
What are the levels of organization starting with the smallest to the largest from a gene and to the cell?
gene, DNA, chromosome, nucleus, cell
Where does DNA replication (synthesis) take place?
Nucleus
Where does transcription take place?
Nucleus
Where does translation take place?
Cytoplasm
List 4 differences between DNA and RNA.
- DNA is double-stranded, and RNA is single-stranded
- DNA uses CATG and RNA uses GUAC
- DNA is in the nucleus while RNA can travel outside the nucleus
- DNA has deoxyribose while RNA has ribose
How many nucleotides code for a codon?
3
Where are proteins made?
Ribosomes in the cytoplasm
4 haploid daughter cells are produced by division of the cytoplasm.
Cytokinesis 2
Homologous chromosomes condense and cross over.
Prophase 1
DNA is synthesized (replicated).
Interphase
Sister chromatids separate away from the center to opposite poles.
Anaphase 2
Sister chromatids condense and become visible.
Prophase 2
Homologous chromosomes line up in the middle of the cell.
Metaphase 1
The cytoplasm splits producing 2 haploid daughter cells.
Cytokinesis 1
Homologous chromosomes are pulled away from the center of the cell to the opposite poles.
Anaphase 1
The nuclear membrane reforms around 2 haploid nuclei but 2 daughter cells have not been formed by cytokinesis yet.
Telophase 1
Sister chromatids line up at the middle of the cell.
Metaphase 2
The nuclear membrane reforms in 2 daughter cells resulting in 4 haploid nuclei, but cytokinesis has not occurred yet.
Telophase 2
This is a strand of DNA that needs to be synthesized (replicated). Insert the appropriate bases: ATCGTTACTGCAACACCCTTACTAAA
TAGCAATGACGTTGTGGGAATGATTT
This is the same strand that needs to be transcribed into RNA using base pair rules:
ATCGTTACTGCAACACCCTTACTAAA
UAGCAAUG-ACG-UUG-UGG-GAA-UGA-UUU
is making a protein from a gene. It involves transcription and translation.
Gene Expression
