Pob 1 struggling topics Flashcards
Ionic bonds
form when one atom donates one or more electron to another
Covalent bond
when 2 atoms share an electron pair
Valence
atoms number of bonds it can form
How many covalent bonds Carbon can make
4 since its valence number is 4
What are hydrogen bond?
are non-covalent bonds formed between electropositive hydrogen and electronegative atom
Structural isomers
have the same molecular formula but different connectivity between atoms
slide 27
Geometric isomers
single bonds make tetrahedra and can rotate
double bonds impose a flat structure: these bonds do not rotate
Cis isomer
has the larger functional groups on the same side
slide 29
Trans isomer
larger functional groups are on opposite sides
slide 29
C=C
molecules can have multipe C=C double bonds: each one could be cis or trans
Chiral
carbon bonded to 4 different functional groups
when stereoisomers occur
How disaccharides form
loss of water (dehydration) to form glycoside linkage
What are the components of a nucleotide
Phosphate groups, sugar (pentose), and nitrogenous base
Exam 3 q3: Which of the following statements about coordinated responses in communication in multicellular organisms is correct?
A. The endocrine system is slow and targets few cells
B. The nervous system is slow and targets many cells
C. The endocrine system is fast and targets a few cells
D. The nervous system is fast and targets a few cells
D= The nervous system is fast and targets a few cells
A= Incorrect:The endocrine system is slow and targets few cells
Exam 3 q6: Why are cattle able to survive on a diet consisting almost entirely of plant material?
E=They have cellulose-digesting, symbiotic microorganisms in chambers of their stomachs
D=Incorrect: Cattle saliva has enzymes capable of digesting cellulose
Exam 3 q9: What would be expected if the amount of interstitial fluid surrounding the capillary beds of the lungs were to increase significantly?
C= The amount of oxygen entering the circulation from the lungs would decrease.
B=Incorrect: The amount of oxygen entering the circulation from the lungs would increase.
Exam 3 q10: Why is gas exchange more difficult for aquatic animals with gills than for terrestrial animals
B= Water contains much less O2 than air per unit volume.
C= Incorrect: Gills have less surface area than lungs
Exam 3 q16: Which of the following differentiates T cells and B cells?
C= T cells but not B cells can directly attack and destroy invading pathogens.
B= Incorrect: Only B cells are produced from stem cells of the bone marrow
Exam 3 q20: The advantage of excreting wastes as urea rather than as ammonia is that
B. Urea is less toxic than ammonia
Incorrect: E. Less nitrogen is removed from the body.
Exam 3 q25: The endocrine system and the nervous system are structurally related. Which of the following cells best illustrates this relationship?
C. A neurosecretory cell in the hypothalamus
Incorrect: D. A brain cell in the cerebral cortex
Exam 3 q26: Which of the following hormone actions will occur when more energy is required by a human?
B. Blood glucagon increases
Incorrect: C. Both insulin and glucagon increase.
Exam 3 q27: Which of the following statements about the hypothalamus is incorrect?
A. It functions as an endocrine gland.
B. It is part of the central nervous system.
C. It is subject to feedback inhibition by certain hormones.
D. It secretes tropic hormones that act directly on the gonads.
E. Its neurosecretory cells terminate in the posterior pituitary.
D. It secretes tropic hormones that act directly on the gonads.
Incorrect: A. It functions as an endocrine gland.
Exam 2 q29: Action potentials move along axons
A. More slowly in axons of large than in small diameter.
B. By the direct action of acetylcholine on the axonal membrane.
C. By activating the sodium-potassium “pump” at each point along the axonal membrane.
D. More rapidly in myelinated than in non-myelinated axons.
E. By reversing the concentration gradients for sodium and potassium ions
D. More rapidly in myelinated than in non-myelinated axons.
Incorrect:C. By activating the sodium-potassium “pump” at each point along the axonal membrane.
Exam 3 q32: The steps below refer to various stages in transmission at a chemical synapse:
1. Neurotransmitter binds with receptors associated with the postsynaptic membrane.
2. Calcium ions rush into the neuron’s cytoplasm.
3. An action potential depolarizes the membrane of the axon terminal.
4. The ligand-gated ion channels open.
5. The synaptic vesicles release neurotransmitters into the synaptic cleft.
C. 3 → 2 → 5 → 1 → 4
Incorrect: D. 4 → 3 → 1 → 2 → 5
Exam 3 q33: When several EPSPs arrive at the axon hillock from different dendritic locations, depolarizing the
postsynaptic cell to threshold for an action potential, this is an example of
B. Spatial summation.
Incorrect: E. An action potential with an abnormally high peak of depolarization.
Exam 3 q1.1 Table
Look at table (Obese, Thin. Obese, Same)
Exam 3 q2.1 Table
Look at table (normal, normal, high. high, high, normal)
Exam 3 q4.2
blood pH
Exam 3 q4.3
cerebrospinal fluid sensors and major blood vessels
Exam 3 q5.1
D. cytotoxic T cells
Exam 3 q5.2
H class I MHC molecules
Exam 3 q5.3
C plasma cells
Exam 3 q6.2
The falling phase of the action potential
Exam 3 q7.2
Cell membrane
Exam 3 q7.3
Contract
Exam 3 q8.1
8.1 Blood vessel dilation in the skin and sweating
How many bonds can C, H, and N form in a molecule?
C=4 bonds
H=1 bond
N=3 bonds
What makes a molecule polar when looking at molecule or side chain
Presence of 02 (oxygen)
polar= more negative, hydrophilic
Polar and non-polar molecules do not mix because:
Non-polar molecules interact less strongly with polar molecules than polar molecules do
with themselves
DNA is normally desiccated or lyophilized (i.e. completely dried out and stored as a dry powder) for long-term storage. Why?
The absence of water prevents hydrolysis of the DNA backbone
How do you determine nitrogenous bases by looking at molecule
Look at nitrogenous base on molecules (search it up)
Which of the following statements about protein structure is not true?
Tertiary (3-dimensional) structure of proteins results exclusively from covalent bonds
formed between amino acid sidechains
How would you expect overexpression of an enzyme that converted carbon-carbon double
bonds in membrane lipids into single bonds (i.e. converting a lot of unsaturated fatty acids to saturated ones) to affect the rate and efficiency of endocytosis – a process that requires diffusion in a fluid plasma membrane?
Endocytosis would be less efficient
Which of the following statements about amino acids is not true?
All amino acid sidechains are non-polar
Which of the following DNA molecules (written 5’-3’) could be attached to magnetic beads and
used to purify an RNA molecule with the sequence: 5’ GCUAAGCUAUGGCGAUGCAAGUU 3’?
AACTTGCATCGCCATAGCTTAGC
Hexokinase is an enzyme that catalyzes the phosphorylation of glucose to produce glucose-6-phosphate (using a phosphate group from ATP). What will happen to the rate of glucose phosphorylation in cells if we add an allosteric regulator of hexokinase that causes it to bind much more tightly to glucose-6-phosphate?
C. The rate of glucose phosphorylation will decrease
allosteric regulator: binds somewhere besides active site, causing change in structure
as it binds tightly it inhibits phosphorylation of glucose
For the exergonic conversion of ATP to ADP + phosphate, which of the following has the lowest free energy?
ADP + phosphate
gibbs free energy: change G= change H - Tchange S
products have lower free energy (energy released to its surroundings)
Theoretically, the energy released by oxidation of NADH to NAD+ (∆G for this oxidation reaction is -52.6 kcal/mol) could be used to synthesize how many molecules of ATP from ADP (∆G for ATP hydrolysis to ADP is -7.3 kcal/mol)
Up to 7
divide both numbers and choose number closest to it
Which of the following processes occur in mitochondria?
Pyruvate oxidation, the TCA cycle and oxidative phosphorylation
Which of the following are the net products of glycolysis
NADH, ATP and Pyruvate
glucose> 2 pyruvate + 2H2O
4 atp formed - 2 ATP used > 2 ATP
2 NAD+ + 4electrons + 4 H+ > 2 NADH + 2H+
Which of the following is not directly consumed (i.e. converted to something else) by the Citric
Acid (Krebs) cycle?
Oxygen
Kreb cycle: an areobic process that occurs in the mitochondria, 02 is used as an electron transport chain; kreb accepts electrons
If we add an inhibitor that completely stops pyruvate oxidation, which of the following processes will also stop?
Glycolysis, the Citric Acid (Krebs) cycle and oxidative phosphorylation
glycolysis (can occur w/out oxygen but this will affect causes pyruvate to not enter mitochondria) > Kreb cycle (NADH and FADH2 needs oxidation of acetyl-coa derived from pyruvate breakdown; lack of acetly disrupts cycle) > Pyruvate oxidation ( needs ETC and synthesis of ATP needs electrons carries NADH and FADH2)
glycolysis> kreb cycles> oxidation phosphorylation
Which of the following statements about photosynthesis is not true?
C4 and CAM plants do not contain RuBisCO or run the Calvin cycle
If a plant (note, not a C4 or CAM plant) leaves its stomata closed while both the light reactions of photosynthesis and the Calvin cycle are both running, why will the Calvin cycle become increasingly impaired over time?
Oxygen levels increase while carbon dioxide levels decrease
open stomata= gas exchange
closed stomata=less CO2 from atmosphere comes in; light rxn continues
decreases efficiency of carbon fixation
2-4 DNP is a proton ionophore that uncouples proton gradients across biological membranes.
Predict the effect on ATP and NADPH synthesis via photosynthesis if you treat a plant with 2-4
DNP
ATP synthesis will immediately stop, while NADPH synthesis will continue
ATP:Proton gradient accross thylakoid memb. is important for ATP sythesis 2,4 DNP disrupts proton gradient by uncoupling protons from ATP synthase, preventing ATP synthsis, stopping ATP
NADPH: light-dependent rxn, involving the movement of electrons through thylakoid memb. 2,4 DNP does not directly affect the movement of electrons
Plants can use cyclic electron flow around photosystem I. Instead of taking electrons from water and passing them to NADP+, the plant passes electrons from P700+ to Pheoplytin (just to the right of photosystem II in the diagram); electrons flow down the ETC back to P700. P700 absorbs a photon and the process repeats (electrons go back to Pheoplytin, etc)
I didn’t discuss this in the videos, but it’s based on a question on the practice midterm exam and in any case all the information you need is in the diagram above. If a plant switches to cyclic electron flow around photosystem I and stops ‘normal’ Z-scheme transfer through both photosystems
(Look at question 24 on exam practice 1)
Generation of oxygen is reduced, ATP synthesis continues, and CO2 fixation in the
Calvin cycle is reduced
Which of the following statements about DNA replication is not true?
DNA replication requires 2’-3’ dideoxy NTPs (ddNTPs) and cannot occur without them
If DNA replication had a synthesis error rate of 1 in 100, proofreading by the DNA polymerase
had an error rate of 1 in 10, and there was no mismatch repair system to catch errors, what
would be the overall error rate of DNA replication?
1 in 1000
1/100 times 1/10
You identify a mutant strain of E. coli and analyze the products of DNA replication in the strain. The cells can replicate all of their genomic DNA, but careful analysis reveals that both leading strands and all Okazaki fragments start with short stretches of RNA, which have not been removed. The 5’-3’ exonuclease activity of which of the following enzymes has most likely been impacted by the mutation?
DNA Polymerase I
DNA Polymerase I - removes primers
DNA Polymerase II - DNA replication and repair in prokaryotes; fills in gaps that come from DNA damage
DNA Polymerase III - elongates DNA strands; leading and lagging strand sequences
What is the role of reverse transcriptase in RT-PCR?
Creates a complementary DNA copy of an RNA, allowing this sequence to be amplified
You have DNA molecules that are 100, 1000, 10000 and 100000 base pairs (bp) long. If you
apply a current, all the molecules will move towards the positively charged electrode: which molecule will move fastest through a (liquid) salt solution; which will move fastest through an agarose gel?
All molecules move at the same speed through liquid; 100bp molecule moves fastest
through an agarose gel
Which of the following is not absolutely required for PCR
NTPs
PCR=polymerase chain rxn
relies on dNTPs not NTPs
Which of the following statements about next-generation DNA sequencing (NGS) is not true?
NGS involves annealing a radioactive primer to a DNA template, extending it with a mix
of dNTPs and ddNTPs, then separating the products in a gel
sanger sequencing
Cancer cells do a lot of glycolysis and not much oxidative phosphorylation; this allows them to:
Keep much of the carbon from glucose to build macromolecules
glycolysis provide a quick source of energy in the form of ATP and allows cancer to direct carbon from glucose into biosynthetic passways
What role(s) do telomeres play in the replication and maintenance of linear chromosomes? (question 34 exam 1)
Both C and D (i.e. mitigate/counteract the shortening of chromosomes, and prevent ends
from being recognized as damage).
Telomeres allow cells to migrate and counter act the loss of DNA during lagging-strand synthesis; helps chromosomes from being recognized as damaged
Look at short answer responses on Exam 1
look at itttttt you got this Awa!
